Table 1: The coding sequences of the first exon of -globin gene of different species.

Species Coding sequence

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGT
HumanTACTGCCCTGTGGGGCAAGGTGAACGTGGATTAAG
TTGGTGGTGAGGCCCTGGGCAG
ATGCTGACTGCTGAGGAGAAGGCTGCCGTCACCGG
GoatCTTCTGGGGCAAGGTGAAAGTGGATGAAGTTGGTG
CTGAGGCCCTGGGCAG
ATGGTGCACTTGACTTCTGAGGAGAAGAACTGCA
OpossumTCACTACCATCTGGTCTAAGGTGCAGGTTGACCA
GACTGGTGGTGAGGCCCTTGGCAG
ATGGTGCACTGGACTGCTGAGGAGAAGCAGCTCAT
GallusCACCGGCCTCTGGGGGAAGGTCAATGTGGCCGAAT
GTGGGGCCGAAGCCCTGGCCAG
ATGACTTTGCTGAGTGCTGAGGAGAATGCTCATGT
LemurCACCTCTCTGTGGGGCAAGGTGGATGTAGAGAAAG
TTGGTGGCGAGGCCTTGGGCAG
ATGGTTGCACCTGACTGATGCTGAGAAGTCTGCTG
MouseTCTCTTGCCTGTGGGCAAAGGTGAACCCCGATGAA
GTTGGTGGTGAGGCCCTGGGCAGG
ATGGTGCATCTGTCCAGTGAGGAGAAGTCTGCGGT
RabbitCACTGCCCTGTGGGGCAAGGTGAATGTGGAAGAAG
TTGGTGGTGAGGCCCTGGGC
ATGGTGCACCTAACTGATGCTGAGAAGGCTACTGT
RatTAGTGGCCTGTGGGGAAAGGTGAACCCTGATAATG
TTGGCGCTGAGGCCCTGGGCAG
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGT
GorillaTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGG