Table 1: PCR primers to quantitatively measure the mRNA levels of PEPT1, PEPT2, ALAS1, ALAD, HMBS, UROS, UROD, ABCB6 CPOX, PPOX, ABCG2, FECH, HO-1, and HIF1alpha.

GeneF/RPrimer sequencePositionTm

PEPT1ForwardCCCTGAAGTGAAGGTGTTTGAAGATA1772–179760.6
NM_005073ReverseGAATTGGCCCCTGACATGAA2168–218859.3
PEPT2ForwardCTACCACAATATGCCCTGGTTACA1894–191758.8
NM_001145998ReverseGCCACTGAACTGTGCCACAA2045–206459.3
ALAS1ForwardGGATTCGAAACAGCCGAGTG1371–139059.3
NM 000688ReverseGAAGGTGATTGCTCCAAACTCAT1542–156458.3
ALADForwardCCTCGGTTCCAACCAACTGAT157–17759.8
NM_000031ReverseGATAGGCTGTATGTCATCAGGAACA319–34358.2
HMBSForwardCAAGGACCAGGACATCTTGGAT835–85658.9
NM_000190ReverseCCAGACTCCTCCAGTCAGGTACA984–100659.2
UROSForwardTCAGCACTGCCTCTTCTATTTCC668–69158.7
NM_000375ReverseCTGGGTGTGCAACTGTCTGATAC761–78958.3
URODForwardCGGGAGTGTGTGGGGAA982–99857.2
NM_000374ReverseAAGCAGACGTGAGTGTTTATGCA1178–120058.6
ABCB6ForwardCAGAAGGGCCGTATTGAGTTTG2033–205459.6
NM_005689ReverseATTGTCGGCGATGGTGTCA2308–232659.5
CPOXForwardGGCGGAGATGTTGCCTAAGAC401–42159.7
NM_000097ReverseAATGCTCACCCCAGCCTTTT709–72859.5
PPOXForwardCAGGAGTCCTGGGAATCGTGTA1251–127259.9
NM_000309ReverseTGCCTAGCTGACTCTAGTTTTTGC1509–153358.1
FECHForwardGGAAATCCATTGTTCTCTAAGGC1252–127457.0
NM_001012515ReverseCTAAATAACACCCTCTCCACATCG1462–148557.8
ABCG2ForwardCTAAGCAGGGACGAACAATCATC1188–121058.8
NM_004827ReverseTCCTGCTTGGAAGGCTCTATG1447–146758.2
HIF-1alphaForwardGGCGCGAACGACAAGAA420–43658.0
NM 001530ReverseCAAAACCATCCAAGGCTTTCA682–70258.7
HO-1ForwardGCTCAAAAAGATTGCCCAGAA518–53858.1
NM_002133ReverseTCACATGGCATAAAGCCCTACA926–94759.1

PEPT1: oligopeptide transporter 1; PEPT2: oligopeptide transporter 2; ALAS1: delta-aminolevulinate synthase 1; ALAD, delta-aminolevulinate dehydratase; HMBS: hydroxymethylbilane synthase; UROS: uroporphyrinogen III synthase; UROD: uroporphyrinogen decarboxylase; ABCB6: ABC transporter B6; CPOX: coproporphyrinogen oxidase; PPOX: protoporphyrinogen oxidase; FECH: ferrochelatase; ABCG2: ABC transporter G2 (BCRP); HIF-1alpha: hypoxia inducible factor-1 alpha subunit; HO-1: heme oxygenase-1. F/R: forward or reverse primers; Tm: melting temperature.