Table 1: Oligonucleotides used in this study.

PrimerSequence (5′–3′)Description

RT1.for/revAATATGCCCTGGAGATAGCG/AGACGACACTTTCCGATACGUsed in quantitative PCR for plasmid copy number determination
RT2.for/revATGCACGAATGCCTACTCTC/GGGCAAAGGAAGGCTTAAAC
16S-Pt.for/revTCGTCCTTCCAGGATTACAG/CCGGCTTTGTAAATCTCCAG
RC1.rev1/2TCGGATTTAACAGGGCGTCTA/CCTGAACTGCCTGTTATCAATORF1 inner/outer 5′RACE
RC2.rev1/2CAATAGGGTGGAGATGTTATAGC/TCAAAGCCCAGCCATTAGATTGCORF2 inner/outer 5′RACE
RC3.rev1/2TTACCTGACCCTTTATTTCC/TCCAGGGCGTTTAAGTAAATGORF3 inner/outer 5′RACE
RC4.rev1/2TTTCCCTGATATTCCCTTATCC/ACATCTCTTGGTATGCCTTTCORF4 inner/outer 5′RACE
RC5.rev1/2TCGGAGTAGAATTTACCTGTAG/GGATAAGGATTACCTCTGTTAGORF5 inner/outer 5′RACE
RC6.rev1/2GCATTTAGGACAGGTCGCATAC/ACTCACTACCACTTACATACORF6 inner/outer 5′RACE