Bioinorganic Chemistry and Applications http://www.hindawi.com The latest articles from Hindawi Publishing Corporation © 2013 , Hindawi Publishing Corporation . All rights reserved. Fast Disinfection of Escherichia coli Bacteria Using Carbon Nanotubes Interaction with Microwave Radiation Sat, 30 Mar 2013 14:01:55 +0000 http://www.hindawi.com/journals/bca/2013/458943/ Water disinfection has attracted the attention of scientists worldwide due to water scarcity. The most significant challenges are determining how to achieve proper disinfection without producing harmful byproducts obtained usually using conventional chemical disinfectants and developing new point-of-use methods for the removal and inactivation of waterborne pathogens. The removal of contaminants and reuse of the treated water would provide significant reductions in cost, time, liabilities, and labour to the industry and result in improved environmental stewardship. The present study demonstrates a new approach for the removal of Escherichia coli (E. coli) from water using as-produced and modified/functionalized carbon nanotubes (CNTs) with 1-octadecanol groups (C18) under the effect of microwave irradiation. Scanning/transmission electron microscopy, thermogravimetric analysis, and FTIR spectroscopy were used to characterise the morphological/structural and thermal properties of CNTs. The 1-octadecanol (C18) functional group was attached to the surface of CNTs via Fischer esterification. The produced CNTs were tested for their efficiency in destroying the pathogenic bacteria (E. coli) in water with and without the effect of microwave radiation. A low removal rate (3–5%) of (E. coli) bacteria was obtained when CNTs alone were used, indicating that CNTs did not cause bacterial cellular death. When combined with microwave radiation, the unmodified CNTs were able to remove up to 98% of bacteria from water, while a higher removal of bacteria (up to 100%) was achieved when CNTs-C18 was used under the same conditions. Samer M. Al-Hakami, Amjad B. Khalil, Tahar Laoui, and Muataz Ali Atieh Copyright © 2013 Samer M. Al-Hakami et al. All rights reserved. Synthesis, Characterization, Mössbauer Parameters, and Antitumor Activity of Fe(III) Curcumin Complex Wed, 27 Mar 2013 18:25:59 +0000 http://www.hindawi.com/journals/bca/2013/982423/ Curcumin-Fe(III) complex was prepared from Fe(NO3)3·9H2O precursor and curcumin by refluxing a slightly basic methanolic solution of their mixture with the objective of investigating its cytotoxicity. The enol form of curcumin ligand was established by FTIR, UV/Vis, 1H NMR, and 13C NMR spectroscopy. The as-prepared product was characterized by elemental analysis, FTIR, UV, and Mössbauer spectroscopic techniques. An octahedral high-spin Fe(III) complex was obtained, δ, 0.37 mms−1; Q.S., 0.79 mms−1; no magnetic relaxation was observed at liquid N2 temperature, neither reduction of Fe(III). The tested cytotoxicity of the as-prepared complex on four cancer cell lines indicated inhibition of the curcumin activity upon complexing with iron. Mutasim Ibrahim Khalil, Aisha Mohamed Al-Zahem, and Maha Hamad Al-Qunaibit Copyright © 2013 Mutasim Ibrahim Khalil et al. All rights reserved. Synthesis, Characterization, and Antibacterial Studies of Pd(II) and Pt(II) Complexes of Some Diaminopyrimidine Derivatives Tue, 12 Mar 2013 15:26:24 +0000 http://www.hindawi.com/journals/bca/2013/549549/ Pd(II) and Pt(II) complexes of trimethoprim and pyrimethamine were synthesized and characterized by elemental analysis, UV-Vis, FTIR, and NMR spectroscopy. The complexes are formulated as four coordinate square planar species containing two molecules of the drugs and two chloride or thiocyanate ions. The coordination of the metal ions to the pyrimidine nitrogen atom of the drugs was confirmed by spectroscopic analyses. The complexes were screened for their antibacterial activities against eight bacterial isolates. They showed varied activities with the active metal complexes showing more enhanced inhibition than either trimethoprim or pyrimethamine. The Pd(II) complexes of pyrimethamine showed unique inhibitory activities against P. aeruginosa and B. pumilus, and none of the other complexes or the drugs showed any activity against these bacteria isolates. The MIC and MBC determinations revealed that these Pd(II) complexes are the most active. Structure activity relationship showed that Pt(II) complexes containing chloride ions are more active, while for Pd(II) complexes containing thiocyanate ions showed more enhanced activity than those containing chloride ions. Peter A. Ajibade and Omoruyi G. Idemudia Copyright © 2013 Peter A. Ajibade and Omoruyi G. Idemudia. All rights reserved. Synthesis, Characterization, and Interaction with Biomolecules of Platinum(II) Complexes with Shikimic Acid-Based Ligands Tue, 05 Mar 2013 15:58:12 +0000 http://www.hindawi.com/journals/bca/2013/565032/ Starting from the active ingredient shikimic acid (SA) of traditional Chinese medicine and NH2(CH2)nOH, (–6), we have synthesized a series of new water-soluble Pt(II) complexes PtLa–eCl2, where La–e are chelating diamine ligands with carbon chain covalently attached to SA (La–e = SA-NH(CH2)nNHCH2CH2NH2; La, ; Lb, ; Lc, ; Ld, ; Le, ). The results of the elemental analysis, LC-MS, capillary electrophoresis, and 1H, 13C NMR indicated that there was only one product (isomer) formed under the present experimental conditions, in which the coordinate mode of PtLa–eCl2 was two-amine bidentate. Their in vitro cytotoxic activities were evaluated by MTT method, where these compounds only exhibited low cytotoxicity towards BEL7404, which should correlate their low lipophilicity. The interactions of the five Pt(II) complexes with DNA were investigated by agarose gel electrophoresis, which suggests that the Pt(II) complexes could induce DNA alteration. We also studied the interactions of the Pt(II) complexes with -GMP with ESI-MS and 1H NMR and found that PtLbCl2, PtLcCl2, and PtLdCl2 could react with -GMP to form mono-GMP and bis-GMP adducts. Furthermore, the cell-cycle analysis revealed that PtLbCl2, PtLcCl2 cause cell G2-phase arrest after incubation for 72 h. Overall, these water-soluble Pt(II) complexes interact with DNA mainly through covalent binding, which blocks the DNA synthesis and replication and thus induces cytotoxicity that weakens as the length of carbon chain increases. Yan Peng, Min-Min Zhang, Zhen-Feng Chen, Kun Hu, Yan-Cheng Liu, Xia Chen, and Hong Liang Copyright © 2013 Yan Peng et al. All rights reserved. Synthesis, CP-MAS NMR Characterization, and Antibacterial Activities of Glycine and Histidine Complexes of Cd(SeCN)2 and Hg(SeCN)2 Thu, 28 Feb 2013 10:45:52 +0000 http://www.hindawi.com/journals/bca/2013/476874/ The synthesis and characterization of cadmium and mercury complexes of selenocyanate of the type [(L)M(SeCN)2] are described, where L is L-Histidine (His) or L-Glycine (Gly) and M is Cd2+ or Hg2+. These complexes are obtained by the reaction of 1 equivalent of respective amino acids with metal diselenocyanate precursor in a mixture of solvents (methanol : water = 1 : 1). These synthesized compounds are characterized by analytical and various spectroscopic techniques such as elemental analysis (EA), IR, and NMR in solution and in the solid state for and . The in vitro antibacterial activities of these complexes have been investigated with standard type cultures of Escherichia coli (MTCC 443), Klebsiella pneumoniae (MTCC 109), Pseudomonas aeruginosa (MTCC 1688), Salmonella typhi (MTCC 733), and Staphylococcus aureus (MTCC 737). Bassem A. Al-Maythalony, M. Monim-ul-Mehboob, Mohammed I. M. Wazeer, Anvarhusein A. Isab, M. Nasiruzzaman Shaikh, and Saleh Altuwaijri Copyright © 2013 Bassem A. Al-Maythalony et al. All rights reserved. Preparation and Characterization of Hydroxyapatite Coating on AZ31 Mg Alloy for Implant Applications Thu, 21 Feb 2013 08:52:38 +0000 http://www.hindawi.com/journals/bca/2013/175756/ Magnesium alloys as biodegradable metal implants in orthopaedic research received a lot of interest in recent years. They have attractive biological properties including being essential to human metabolism, biocompatibility, and biodegradability. However, magnesium can corrode too rapidly in the high-chloride environment of the physiological system, loosing mechanical integrity before the tissue has sufficiently healed. Hydroxyapatite (HAp) coating was proposed to decrease the corrosion rate and improve the bioactivity of magnesium alloy. Apatite has been cathodically deposited on the surface of Mg alloy from solution that composed of 3 mM Ca(H2PO4)2 and 7 mM CaCl2 at various applied potentials. The growing of HAp was confirmed on the surface of the coatings after immersion in SBF solution for 7 days. The coating obtained at −1.4 V showed higher corrosion resistance with bioactive behaviors. S. A. Salman, K. Kuroda, and M. Okido Copyright © 2013 S. A. Salman et al. All rights reserved. Synthesis and In Vitro Antitumor Activity of Two Mixed-Ligand Oxovanadium(IV) Complexes of Schiff Base and Phenanthroline Tue, 29 Jan 2013 10:15:29 +0000 http://www.hindawi.com/journals/bca/2013/437134/ Two oxovanadium(IV) complexes of [VO(msatsc)(phen)], (1) (msatsc = methoxylsalicylaldehyde thiosemicarbazone, phen = phenanthroline) and its novel derivative [VO (4-chlorosatsc)(phen)], (2) (4-chlorosatsc = 4-chlorosalicylaldehyde thiosemicarbazone), have been synthesized and characterized by elemental analysis, IR, ES-MS, 1H NMR, and magnetic susceptibility measurements. Their antitumor effects on BEL-7402, HUH-7, and HepG2 cells were studied by MTT assay. The antitumor biological mechanism of these two complexes was studied in BEL-7402 cells by cell cycle analysis, Hoechst 33342 staining, Annexin V-FITC/PI assay, and detection of mitochondrial membrane potential (ΔΨm). The results showed that the growth of cancer cells was inhibited significantly, and complexes 1 and 2 mainly caused in BEL-7402 cells G0/G1 cell cycle arrest and induced apoptosis. Both 1 and 2 decreased significantly the ΔΨm, causing the depolarization of the mitochondrial membrane. Complex 2 showed greater antitumor efficiency than that of complex 1. Yongli Zhang, Xiangsheng Wang, Wei Fang, Xiaoyan Cai, Fujiang Chu, Xiangwen Liao, and Jiazheng Lu Copyright © 2013 Yongli Zhang et al. All rights reserved. Osteoconductivity and Hydrophilicity of TiO2 Coatings on Ti Substrates Prepared by Different Oxidizing Processes Tue, 18 Dec 2012 10:08:35 +0000 http://www.hindawi.com/journals/bca/2012/495218/ Various techniques for forming TiO2 coatings on Ti have been investigated for the improvement of the osteoconductivity of Ti implants. However, it is not clear how the oxidizing process affects this osteoconductivity. In this study, TiO2 coatings were prepared using the following three processes: anodizing in 0.1 M H3PO4 or 0.1 M NaOH aqueous solution; thermal oxidation at 673 K for 2 h in air; and a two-step process of anodizing followed by thermal oxidation. The oxide coatings were evaluated using SEM, XRD, and XPS. The water contact angle on the TiO2 coatings was measured as a surface property. The osteoconductivity of these samples was evaluated by measuring the contact ratio of formed hard tissue on the implanted samples (defined as the value) after 14 d implantation in rats' tibias. Anatase was formed by anodizing and rutile by thermal oxidation, but the difference in the TiO2 crystal structure did not influence the osteoconductivity. Anodized TiO2 coatings were hydrophilic, but thermally oxidized TiO2 coatings were less hydrophilic than anodized TiO2 coatings because they lacked in surface OH groups. The TiO2 coating process using anodizing without thermal oxidation gave effective improvement of the osteoconductivity of Ti samples. Dai Yamamoto, Ikki Kawai, Kensuke Kuroda, Ryoichi Ichino, Masazumi Okido, and Azusa Seki Copyright © 2012 Dai Yamamoto et al. All rights reserved. Studies on Synthetic and Natural Melanin and Its Affinity for Fe(III) Ion Thu, 06 Dec 2012 11:34:46 +0000 http://www.hindawi.com/journals/bca/2012/712840/ In this work, we measured the metal-binding sites of natural and synthetic dihydroxyindole (DHI) melanins and their respective interactions with Fe(III) ions. Besides the two acid groups detected for the DHI system: catechol (Cat) and quinone-imine (QI), acetate groups were detected in the natural oligomer by potentiometric titrations. At acidic pH values, Fe(III) complexation with synthetic melanin was detected in an Fe(OH)(CatH2Cat) interaction. With an increase of pH, three new interactions occurred: dihydroxide diprotonated catechol, Fe(OH)2(CatH2Cat)−, dihydroxide monoprotonated catechol, [Fe(OH)2(CatHCat)]2−, and an interaction resulting from the association of one quinone-imine and a catechol group, [Fe(OH)2(Qi−)(CatHCat)]3−. In the natural melanin system, we detected the same interactions involving catechol and quinone-imine groups but also the metal interacts with acetate group at pH values lower than 4.0. Furthermore, interactions in the synthetic system were also characterized by infrared spectroscopy by using the characteristic vibrations of catechol and quinone-imine groups. Finally, scanning electronic microscopy (SEM) and energy-dispersive X-ray (EDS) analysis were used to examine the differences in morphology of these two systems in the absence and presence of Fe(III) ions. The mole ratio of metal and donor atoms was obtained by the EDS analysis. T. G. Costa, R. Younger, C. Poe, P. J. Farmer, and B. Szpoganicz Copyright © 2012 T. G. Costa et al. All rights reserved. Thermodynamic Investigation and Mixed Ligand Complex Formation of 1,4-Bis-(3-aminopropyl)-piperazine and Biorelevant Ligands Mon, 26 Nov 2012 14:29:54 +0000 http://www.hindawi.com/journals/bca/2012/984291/ Thermodynamic parameters for protonation of 1,4-bis(3-aminopropyl)-piperazine (BAPP) and its metal complexation with some divalent metal ions were determined in aqueous solution at constant ionic strength (0.1 M NaNO3) using a potentiometric technique. The order of –ΔG0 and –ΔH0 was found to obey , in accordance with the Irving-Williams order. The formation equilibria of zinc (II) complexes and the ternary complexes Zn(BAPP)L, where L = amino acid, amides, or DNA constituents), have been investigated. Ternary complexes are formed by a simultaneous mechanism. The concentration distribution of the complexes in solution was evaluated as a function of pH. Stoichiometry and stability constants for the complexes formed are reported and discussed. The stability of ternary complexes was quantitatively compared with their corresponding binary complexes in terms of the parameter Δlog K. Ahmed A. El-Sherif, Mohamed R. Shehata, Mohamed M. Shoukry, and Mohammad H. Barakat Copyright © 2012 Ahmed A. El-Sherif et al. All rights reserved. Spectroscopic, Thermal, and Antimicrobial Studies of Co(II), Ni(II), Cu(II), and Zn(II) Complexes Derived from Bidentate Ligands Containing N and S Donor Atoms Thu, 22 Nov 2012 08:25:21 +0000 http://www.hindawi.com/journals/bca/2012/729708/ Two new heterocyclic Schiff bases of 4-amino-5-mercapto-3-H/propyl-1,2,4-triazole and 5-nitrofurfuraldehyde [] and their cobalt, nickel, copper, and zinc complexes have been synthesized and characterized by elemental analyses, spectral (UV-Vis, IR, 1H NMR, Fluorescence, and ESR) studies, thermal techniques, and magnetic moment measurements. The heterocyclic Schiff bases act as bidentate ligands and coordinate with metal ions through nitrogen and sulphur of the thiol group. The low molar conductance values in DMF indicate that the metal complexes are nonelectrolytes. The magnetic moments and electronic spectral data suggest octahedral geometry for the Co(II), Ni(II), and Zn(II) complexes and square planar for Cu(II) complexes. Two Gram-positive bacteria (Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121), two Gram-negative bacteria (Escherichia coli MTCC 1652 and Pseudomonas aeruginosa MTCC 741), and one yeast, Candida albicans, were used for the evaluation of antimicrobial activity of the newly synthesized compounds. Kiran Singh, Yogender Kumar, Parvesh Puri, and Gulab Singh Copyright © 2012 Kiran Singh et al. All rights reserved. Computational Study of the Structure of a Sepiolite/Thioindigo Mayan Pigment Thu, 01 Nov 2012 08:32:35 +0000 http://www.hindawi.com/journals/bca/2012/672562/ The interaction of thioindigo and the phyllosilicate clay sepiolite is investigated using density functional theory (DFT) and molecular orbital theory (MO). The best fit to experimental UV/Vis spectra occurs when a single thioindigo molecule attaches via Van der Waals forces to a tetrahedrally coordinated cation with an additional nearby tetrahedrally coordinated also present. The thioindigo molecule distorts from its planar structure, a behavior consistent with a color change. Due to the weak interaction between thioindigo and sepiolite we conclude that the thioindigo molecule must be trapped in a channel, an observation consistent with previous experimental studies. Future computational studies will look at the interaction of indigo with sepiolite. Manuel Alvarado Jr., Russell C. Chianelli, and Roy M. Arrowood Copyright © 2012 Manuel Alvarado Jr. et al. All rights reserved. Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL Wed, 24 Oct 2012 09:38:38 +0000 http://www.hindawi.com/journals/bca/2012/649640/ The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells. Fangxing Xiao, Xiaobin Yao, Qianhong Bao, Danzhen Li, and Yi Zheng Copyright © 2012 Fangxing Xiao et al. All rights reserved. Synthesis, Spectroscopic Characterization, and In Vitro Antimicrobial Studies of Pyridine-2-Carboxylic Acid N′-(4-Chloro-Benzoyl)-Hydrazide and Its Co(II), Ni(II), and Cu(II) Complexes Mon, 22 Oct 2012 08:35:26 +0000 http://www.hindawi.com/journals/bca/2012/104549/ N-substituted pyridine hydrazide (pyridine-2-carbonyl chloride and 4-chloro-benzoic acid hydrazide) undergoes hydrazide formation of the iminic carbon nitrogen double bond through its reaction with cobalt(II), nickel(II), and copper(II) metal salts in ethanol which are reported and characterized based on elemental analyses, IR, solid reflectance, magnetic moment, molar conductance, and thermal analysis (TG). From the elemental analyses data, 1 : 2 metal complexes are formed having the general formulae [MCl2(HL)2] · yH2O (where M = Co(II), Ni(II), and Cu(II), y = 1–3). The important infrared (IR) spectral bands corresponding to the active groups in the ligand and the solid complexes under investigation were studied. IR spectra show that ligand is coordinated to the metal ions in a neutral bidentate manner with ON donor sites. The solid complexes have been synthesized and studied by thermogravimetric analysis. All the metal chelates are found to be nonelectrolytes. From the magnetic and solid reflectance spectra, the complexes (cobalt(II), nickel(II), and copper(II)) have octahedral and square planner geometry, respectively. The antibacterial and antifungal activity’s data show that the metal complexes have a promising biological activity comparable with the parent ligand against bacterial and fungal species. Jagvir Singh and Prashant Singh Copyright © 2012 Jagvir Singh and Prashant Singh. All rights reserved. Spectroscopic Characterization and Biological Activity of Mixed Ligand Complexes of Ni(II) with 1,10-Phenanthroline and Heterocyclic Schiff Bases Tue, 02 Oct 2012 09:03:47 +0000 http://www.hindawi.com/journals/bca/2012/948534/ Mixed ligand complexes of Ni(II) with 1,10-phenanthroline (1,10-Phen) and Schiff bases L1(MIIMP); L2(CMIIMP); L3(EMIIMP); L4(MIIMNP); L5(MEMIIMP); L6(BMIIMP); L7(MMIIMP); L8(MIIBD) have been synthesized. These metal chelates have been characterized by elemental analysis, IR, 1H-NMR, 13C-NMR, Mass, UV-Vis, magnetic moments, and thermogravimetric (TG&DTA) analysis. Spectral data showed that the 1,10-phenanthroline act as neutral bidentate ligand coordinating to the metal ion through two nitrogen donor atoms and Schiff bases acts as monobasic bidentate coordinating through NO donor atoms. All Ni(II) complexes appear to have an octahedral geometry. The antimicrobial activity of mixed ligand complexes has been studied by screening against various microorganisms, it is observed that the activity enhances upon coordination. The DNA binding studies have been investigated by UV-Vis spectroscopy, and the experimental results indicate that these complexes bind to CT DNA with the intrinsic binding constant  M−1. MTT is used to test the anticancer effect of the complexes with HL60 tumor cell. The inhibition ratio was accelerated by increasing the dosage, and it had significant positive correlation with the medication dosage. Y. Prashanthi, K. Kiranmai, Ira, Sathish kumar K, Vijay kumar Chityala, and Shivaraj Copyright © 2012 Y. Prashanthi et al. All rights reserved. DNA-Binding and Topoisomerase-I-Suppressing Activities of Novel Vanadium Compound Van-7 Sun, 30 Sep 2012 09:54:59 +0000 http://www.hindawi.com/journals/bca/2012/756374/ Vanadium compounds were studied during recent years to be considered as a representative of a new class of nonplatinum metal anticancer agents in combination to its low toxicity. Here, we found a vanadium compound Van-7 as an inhibitor of Topo I other than Topo II using topoisomerase-mediated supercoiled DNA relaxation assay. Agarose gel electrophoresis and comet assay showed that Van-7 treatment did not produce cleavable complexes like HCPT, thereby suggesting that Topo I inhibition occurred upstream of the relegation step. Further studies revealed that Van-7 inhibited Topo I DNA binding involved in its intercalating DNA. Van-7 did not affect the catalytic activity of DNase I even up to100 μM. Van-7 significantly suppressed the growth of cancer cell lines with IC50 at nanomolar concentrations and arrested cell cycle of A549 cells at G2/M phase. All these results indicate that Van-7 is a potential selective Topo I inhibitor with anticancer activities as a kind of Topo I suppressor, not Topo I poison. Xiao-mei Mo, Zhan-fang Chen, Xin Qi, Yan-tuan Li, and Jing Li Copyright © 2012 Xiao-mei Mo et al. All rights reserved. Biosorption of Mercury (II) from Aqueous Solutions onto Fungal Biomass Tue, 18 Sep 2012 15:55:27 +0000 http://www.hindawi.com/journals/bca/2012/156190/ The biosorption of mercury (II) on 14 fungal biomasses, Aspergillus flavus I–V, Aspergillus fumigatus I-II, Helminthosporium sp., Cladosporium sp., Mucor rouxii mutant, M. rouxii IM-80, Mucor sp 1 and 2, and Candida albicans, was studied in this work. It was found that the biomasses of the fungus M. rouxii IM-80, M. rouxii mutant, Mucor sp1, and Mucor sp 2 were very efficient removing the metal in solution, using dithizone, reaching the next percentage of removals: 95.3%, 88.7%, 80.4%, and 78.3%, respectively. The highest adsorption was obtained at pH 5.5, at 30°C after 24 hours of incubation, with 1 g/100 mL of fungal biomass. Víctor M. Martínez-Juárez, Juan F. Cárdenas-González, María Eugenia Torre-Bouscoulet, and Ismael Acosta-Rodríguez Copyright © 2012 Víctor M. Martínez-Juárez et al. All rights reserved. SOD-Mimic Cu(II) Dimeric Complexes Involving Kinetin and Its Derivative: Preparation and Characterization Mon, 27 Aug 2012 15:03:07 +0000 http://www.hindawi.com/journals/bca/2012/704329/ Two SOD-mimic active dimeric Cu(II) chlorido complexes of the compositions [Cu2(μ-HL1)4Cl2]Cl2 (1) and [Cu2(μ-HL2)2(μ-Cl)2(HL2)2Cl2] · 4H2O (2) involving the cosmetologically relevant cytokinin kinetin (N6-furfuryladenine, HL1) and its derivative N6-(5-methylfurfuryl)adenine (HL2) have been synthesized and characterized by elemental analysis, infrared, and electronic spectroscopy, ESI+ mass spectrometry, conductivity and temperature dependence of magnetic susceptibility measurements, and thermogravimetric (TG) and differential thermal (DTA) analyses. The results of these methods, particularly the temperature dependence of magnetic susceptibility, showed the complexes to be dimeric with a strong antiferromagnetic exchange (J = −290 cm−1 for complex 1 and J = −160 cm−1 for 2). The complexes have been identified as auspicious SOD-mimics, as their antiradical activity evaluated by the in vitro SOD-mimic assay resulted in the IC50 values equal to 8.13 μM (1) and 0.71 μM (2). Radka Novotná, Zdeněk Trávníček, and Radovan Herchel Copyright © 2012 Radka Novotná et al. All rights reserved. Synthesis Characterization and DNA Interaction Studies of a New Zn(II) Complex Containing Different Dinitrogen Aromatic Ligands Sun, 26 Aug 2012 13:18:35 +0000 http://www.hindawi.com/journals/bca/2012/571913/ A mononuclear complex of Zn(II), [Zn(DIP)2 (DMP)] (NO3)2·2H2O in which DIP is 4,7-diphenyl-1,10-phenanthroline and DMP is 4,4′-dimethyl-2,2′-bipyridine has been prepared and characterized by 1HNMR spectroscopy, FT-IR, UV-Vis and elemental analysis techniques. DNA-binding properties of the complex were studied using UV-vis spectra, circular dichroism (CD) spectra, fluorescence, cyclic voltammetry (CV), and viscosity measurements. The results indicate that this zinc(II) complex can intercalate into the stacked base pairs of DNA and compete with the strong intercalator ethidium bromide for the intercalative binding sites. Nahid Shahabadi and Somaye Mohammadi Copyright © 2012 Nahid Shahabadi and Somaye Mohammadi. All rights reserved. Metals in Medicine Thu, 23 Aug 2012 15:27:14 +0000 http://www.hindawi.com/journals/bca/2012/705907/ Goran N. Kaluđerović, Santiago Gómez-Ruiz, Danijela Maksimović-Ivanić, Reinhard Paschke, and Sanja Mijatović Copyright © 2012 Goran N. Kaluđerović et al. All rights reserved. Binding Studies of a New Water-Soluble Iron(III) Schiff Base Complex to DNA Using Multispectroscopic Methods Tue, 31 Jul 2012 10:50:00 +0000 http://www.hindawi.com/journals/bca/2012/126451/ A novel iron(III) complex [Fe(SF)](ClO4)3.2H2O; in which SF = N,N0-bis{5-[(triphenylphosphonium chloride)-methyl] salicylidene}-o-phenylenediamine) has been synthesized and characterized using different physicochemical methods. The binding of this complex with calf thymus (CT) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, voltammetric studies, and viscosity measurements. The results showed that this complex can bind to DNA via external and groove binding modes. Nahid Shahabadi, Zeinab Ghasemian, and Saba Hadidi Copyright © 2012 Nahid Shahabadi et al. All rights reserved. Immobilization of Laccase in Alginate-Gelatin Mixed Gel and Decolorization of Synthetic Dyes Tue, 31 Jul 2012 09:25:05 +0000 http://www.hindawi.com/journals/bca/2012/823830/ Alginate-gelatin mixed gel was applied to immobilized laccase for decolorization of some synthetic dyes including crystal violet. The immobilization procedure was accomplished by adding alginate to a gelatin solution containing the enzyme and the subsequent dropwise addition of the mixture into a stirred CaCl2 solution. The obtained data showed that both immobilized and free enzymes acted optimally at 50°C for removal of crystal violet, but the entrapped enzyme showed higher thermal stability compared to the free enzyme. The immobilized enzyme represented optimum decolorization at pH 8. Reusability of the entrapped laccase was also studied and the results showed that ca. 85% activity was retained after five successive cycles. The best removal condition was applied for decolorization of seven other synthetic dyes. Results showed that the maximum and minimum dye removal was related to amido black 10B and eosin, respectively. Mehdi Mogharabi, Nasser Nassiri-Koopaei, Maryam Bozorgi-Koushalshahi, Nastaran Nafissi-Varcheh, Ghodsieh Bagherzadeh, and Mohammad Ali Faramarzi Copyright © 2012 Mehdi Mogharabi et al. All rights reserved. Fine Tuning of Redox Networks on Multiheme Cytochromes from Geobacter sulfurreducens Drives Physiological Electron/Proton Energy Transduction Tue, 31 Jul 2012 08:52:49 +0000 http://www.hindawi.com/journals/bca/2012/298739/ The bacterium Geobacter sulfurreducens (Gs) can grow in the presence of extracellular terminal acceptors, a property that is currently explored to harvest electricity from aquatic sediments and waste organic matter into microbial fuel cells. A family composed of five triheme cytochromes (PpcA-E) was identified in Gs. These cytochromes play a crucial role by bridging the electron transfer from oxidation of cytoplasmic donors to the cell exterior and assisting the reduction of extracellular terminal acceptors. The detailed thermodynamic characterization of such proteins showed that PpcA and PpcD have an important redox-Bohr effect that might implicate these proteins in the e−/H+ coupling mechanisms to sustain cellular growth. The physiological relevance of the redox-Bohr effect in these proteins was studied by determining the fractional contribution of each individual redox-microstate at different pH values. For both proteins, oxidation progresses from a particular protonated microstate to a particular deprotonated one, over specific pH ranges. The preferred e−/H+ transfer pathway established by the selected microstates indicates that both proteins are functionally designed to couple e−/H+ transfer at the physiological pH range for cellular growth. Leonor Morgado, Joana M. Dantas, Marta Bruix, Yuri Y. Londer, and Carlos A. Salgueiro Copyright © 2012 Leonor Morgado et al. All rights reserved. On the Discovery, Biological Effects, and Use of Cisplatin and Metallocenes in Anticancer Chemotherapy Thu, 12 Jul 2012 10:17:43 +0000 http://www.hindawi.com/journals/bca/2012/140284/ The purpose of this paper is to summarize mode of action of cisplatin on the tumor cells, a brief outlook on the metallocene compounds as antitumor drugs as well as the future tendencies for the use of the latter in anticancer chemotherapy. Molecular mechanisms of cisplatin interaction with DNA, DNA repair mechanisms, and cellular proteins are discussed. Molecular background of the sensitivity and resistance to cisplatin, as well as its influence on the efficacy of the antitumor immune response was evaluated. Furthermore, herein are summarized some metallocenes (titanocene, vanadocene, molybdocene, ferrocene, and zirconocene) with high antitumor activity. Santiago Gómez-Ruiz, Danijela Maksimović-Ivanić, Sanja Mijatović, and Goran N. Kaluđerović Copyright © 2012 Santiago Gómez-Ruiz et al. All rights reserved. A Comparative Interaction between Copper Ions with Alzheimer's β Amyloid Peptide and Human Serum Albumin Mon, 09 Jul 2012 07:14:56 +0000 http://www.hindawi.com/journals/bca/2012/208641/ The interaction of Cu2+ with the first 16 residues of the Alzheimer's amyliod β peptide, Aβ(1–16), and human serum albumin (HSA) were studied in vitro by isothermal titration calorimetry at pH 7.2 and 310 K in aqueous solution. The solvation parameters recovered from the extended solvation model indicate that HSA is involved in the transport of copper ion. Complexes between Aβ(1–16) and copper ions have been proposed to be an aberrant interaction in the development of Alzheimer's disease, where Cu2+ is involved in Aβ(1–16) aggregation. The indexes of stability indicate that HSA removed Cu2+ from Aβ(1–16), rapidly, decreased Cu-induced aggregation of Aβ(1–16), and reduced the toxicity of Aβ(1–16) + Cu2+ significantly. G. Rezaei Behbehani, L. Barzegar, M. Mohebbian, and A. A. Saboury Copyright © 2012 G. Rezaei Behbehani et al. All rights reserved. Alkene Cleavage Catalysed by Heme and Nonheme Enzymes: Reaction Mechanisms and Biocatalytic Applications Tue, 03 Jul 2012 11:39:47 +0000 http://www.hindawi.com/journals/bca/2012/626909/ The oxidative cleavage of alkenes is classically performed by chemical methods, although they display several drawbacks. Ozonolysis requires harsh conditions (−78°C, for a safe process) and reducing reagents in a molar amount, whereas the use of poisonous heavy metals such as Cr, Os, or Ru as catalysts is additionally plagued by low yield and selectivity. Conversely, heme and nonheme enzymes can catalyse the oxidative alkene cleavage at ambient temperature and atmospheric pressure in an aqueous buffer, showing excellent chemo- and regioselectivities in certain cases. This paper focuses on the alkene cleavage catalysed by iron cofactor-dependent enzymes encompassing the reaction mechanisms (in case where it is known) and the application of these enzymes in biocatalysis. Francesco G. Mutti Copyright © 2012 Francesco G. Mutti. All rights reserved. Physicochemical Properties and Cellular Responses of Strontium-Doped Gypsum Biomaterials Thu, 07 Jun 2012 10:31:42 +0000 http://www.hindawi.com/journals/bca/2012/976495/ This paper describes some physical, structural, and biological properties of gypsum bioceramics doped with various amounts of strontium ions (0.19–2.23 wt%) and compares these properties with those of a pure gypsum as control. Strontium-doped gypsum (gypsum:Sr) was obtained by mixing calcium sulfate hemihydrate powder and solutions of strontium nitrate followed by washing the specimens with distilled water to remove residual salts. Gypsum was the only phase found in the composition of both pure and gypsum:Sr, meanwhile a shift into lower diffraction angles was observed in the X-ray diffraction patterns of doped specimens. Microstructure of all gypsum specimens consisted of many rod-like small crystals entangled to each other with more elongation and higher thickness in the case of gypsum:Sr. The Sr-doped sample exhibited higher compressive strength and lower solubility than pure gypsum. A continuous release of strontium ions was observed from the gypsum:Sr during soaking it in simulated body fluid for 14 days. Compared to pure gypsum, the osteoblasts cultured on strontium-doped samples showed better proliferation rate and higher alkaline phosphatase activity, depending on Sr concentration. These observations can predict better in vivo behavior of strontium-doped gypsum compared to pure one. Amir Pouria, Hadis Bandegani, Milad Pourbaghi-Masouleh, Saeed Hesaraki, and Masoud Alizadeh Copyright © 2012 Amir Pouria et al. All rights reserved. Behavior and Distribution of Heavy Metals Including Rare Earth Elements, Thorium, and Uranium in Sludge from Industry Water Treatment Plant and Recovery Method of Metals by Biosurfactants Application Sun, 27 May 2012 09:11:00 +0000 http://www.hindawi.com/journals/bca/2012/173819/ In order to investigate the behavior, distribution, and characteristics of heavy metals including rare earth elements (REEs), thorium (Th), and uranium (U) in sludge, the total and fractional concentrations of these elements in sludge collected from an industry water treatment plant were determined and compared with those in natural soil. In addition, the removal/recovery process of heavy metals (Pb, Cr, and Ni) from the polluted sludge was studied with biosurfactant (saponin and sophorolipid) elution by batch and column experiments to evaluate the efficiency of biosurfactant for the removal of heavy metals. Consequently, the following matters have been largely clarified. (1) Heavy metallic elements in sludge have generally larger concentrations and exist as more unstable fraction than those in natural soil. (2) Nonionic saponin including carboxyl group is more efficient than sophorolipid for the removal of heavy metals in polluted sludge. Saponin has selectivity for the mobilization of heavy metals and mainly reacts with heavy metals in F3 (the fraction bound to carbonates) and F5 (the fraction bound to Fe-Mn oxides). (3) The recovery efficiency of heavy metals (Pb, Ni, and Cr) reached about 90–100% using a precipitation method with alkaline solution. Lidi Gao, Naoki Kano, Yuichi Sato, Chong Li, Shuang Zhang, and Hiroshi Imaizumi Copyright © 2012 Lidi Gao et al. All rights reserved. Binuclear Cu(II) and Co(II) Complexes of Tridentate Heterocyclic Shiff Base Derived from Salicylaldehyde with 4-Aminoantipyrine Mon, 07 May 2012 10:32:26 +0000 http://www.hindawi.com/journals/bca/2012/601879/ New binuclear Co(II) and Co(II) complexes of ONO tridentate heterocyclic Schiff base derived from 4-aminoantipyrine with salicylaldehyde have been synthesized and characterized on the bases of elemental analysis, UV-Vis., FT-IR, and also by aid of molar conductivity measurements, magnetic measurements, and melting points. It has been found that the Schiff bases with Cu(II) or Co(II) ion forming binuclear complexes on (1 : 1) “metal : ligand” stoichiometry. The molar conductance measurements of the complexes in DMSO correspond to be nonelectrolytic nature for all prepared complexes. Distorted octahedral environment is suggested for metal complexes. A theoretical treatment of the formation of complexes in the gas phase was studied, and this was done by using the HyperChem-6 program for the molecular mechanics and semi-empirical calculations. The free ligand and its complexes have been tested for their antibacterial activities against two types of human pathogenic bacteria: the first type (Staphylococcus aureus) is Gram positive and the second type (Escherichia coli) is Gram negative (by using agar well diffusion method). Finally, it was found that compounds show different activity of inhibition on growth of the bacteria. Omar Hamad Shihab Al-Obaidi Copyright © 2012 Omar Hamad Shihab Al-Obaidi. All rights reserved. Synthesis, Characterization and In Vitro Antibacterial Studies of Organotin(IV) Complexes with 2-Hydroxyacetophenone-2-methylphenylthiosemicarbazone (H2dampt) Mon, 30 Apr 2012 08:54:44 +0000 http://www.hindawi.com/journals/bca/2012/698491/ Five new organotin(IV) complexes of 2-hydroxyacetophenone-2-methylphenylthiosemicarbazone [H2dampt, (1)] with formula [RSnCl𝑛−1(dampt)] (where R=Me, 𝑛=2 (2); R=Bu, 𝑛=2 (3); R=Ph, 𝑛=2 (4); R=Me2, 𝑛=1 (5); R=Ph2, 𝑛=1 (6)) have been synthesized by direct reaction of H2dampt (1) with organotin(IV) chloride(s) in absolute methanol. The ligand (1) and its organotin(IV) complexes (2–6) were characterized by CHN analyses, molar conductivity, UV-Vis, FT-IR, 1H, 13C, and 119Sn NMR spectral studies. H2dampt (1) is newly synthesized and has been structurally characterized by X-ray crystallography. Spectroscopic data suggested that H2dampt (1) is coordinated to the tin(IV) atom through the thiolate-S, azomethine-N, and phenoxide-O atoms; the coordination number of tin is five. The in vitro antibacterial activity has been evaluated against Staphylococcus aureus, Enterobacter aerogenes, Escherichia coli, and Salmonella typhi. The screening results have shown that the organotin(IV) complexes (2–6) have better antibacterial activities and have potential as drugs. Furthermore, it has been shown that diphenyltin(IV) derivative (6) exhibits significantly better activity than the other organotin(IV) derivatives (2–5). M. A. Salam, M. A. Affan, Ramkrishna Saha, Fasihuddin B. Ahmad, and Norrihan Sam Copyright © 2012 M. A. Salam et al. All rights reserved.