Table 1: Primer pairs designed to amplify the genes encoding the 13 T. cruzi putative secreted proteins conserved in trypanosomatids and T. cruzi Tubulin (negative control).

T. cruzi GeneDB Gene ID No. Primer sequence s ( a ) F/Rint and F/R product sizes (bp)MW (kDa ) ( b )

Tc00.1047053506417.30F CATGAGCTTACTAGTATGTTGTCTCTGGCAGAAGTGTGT
Rint ACGGTGCCCAAAGGCGTGTA311
R CACACGGAAGCTTTCAATGAT GATGATGATGATGGCGACCAAACCTAGCCATAAG70525.7

Tc00.1047053506155.99F CTGGGGGAATTCATGCGGTGGATTTTTTTGTTACTTGCC
Rint CCGATACGTCCACCACCCCTC336
R CGTCGGAAGCTTCTAGTGATG GTGGTGGTGATGGACAAGTTCGTGGCATGTAATTG73528.1

Tc00.1047053506467.29F ACACGGACTAGTATGATTGTATTGAATGGAATTTCTGAG
Rint CTAATAGTCCGAAGTCGTTGCG309
R CTACACAAGCTTTTAGTGATGG TGATGGTGATGGCTGCGCCTCCACACCGTGC106539.7

Tc00.1047053511901.30F CTGATAGGCACTAGTATGTTTCCGGCGCAGGAATTCCT
Rint CCCCTTTCAGGTGACCATTACAAGAG316
R GCCGTCAAGCTTTTAGTGGTGG TGGTGGTGATGCTCCGCTCCCAACTTCAAACGA104139.8

Tc00.1047053511871.30F CTGATAGGCACTAGTATGCGTCGCACTTTATTTTGTCTG
Rint CTCTCCAACTCGTACGGCGA305
R CTGCAGGCAAGCTTCTAAT GGTGGTGATGGTGATGTTATGATACCGGCATCAAGTCCCC126947.0

Tc00.1047053505789.10F CGCACTCACTAGTATGCCCTCTGGCAAAGCAACTG
Rint TCACTGCTCCGCCCTGGTTTC308
R CGCTCCCTCGAGTTAGTGG TGATGGTGGTGATGGGCAGCATTTACCGACCCTGA148853.6

Tc00.1047053509669.70F GCTCAGCCAAGCTTATGCGCACTTCTTCTGCCGTGT
Rint ATCGGGGAGTTTTGTGCAGGTTGAG322
R GTGGTCTTCTCGAGTTAGTGAT GGTGGTGGTGATGGTCGACTTTAATGCTCGCGTATA194473.1
Tc00.1047053507765.20F CTGCCCAGTACTAGTATGTCTGCTAAAGCCTCACGGC
Rint TCCAGGTAGTCACCCATTCCGTG318
R CTCAGCCAAGCTTTTAATGATG ATGATGATGGTGTCGTCTCGCCTCACAGTGCT152157.2

Tc00.1047053510101.470F CTGCGCTGGACTAGTATGTCTGTTAAAGCCTCACGGCG
Rint CCATTCCGTGACCGCCGTAGAC302
R CTCGGTAAGCTTTTAATGATGA TGATGATGGTGTCGTCTCGCCTCACAGTGCT151857.3

Tc00.1047053510443.30F CTCGCTGGAATTCATGCGGTGGGTGATAGTTGTATTTGC
Rint CGCCAACAACGTAGTTGCCAAG313
R ACGGACCTCGAGTTAGTGATG GTGGTGGTGATGCTTGTTGAGTTTGGAGCGGCG61223.0

Tc00.1047053509799.50F CGCGGGACTAGTATGAAACAAAAAATGCGACGCAAATTG
Rint GTGAGGATGGGGAACCAAAAGAGTC297
R CAGCCAAGCTTCTAGTGAT GGTGATGATGATGGACATTCTTCTTCTTTGTAAAGTAG68726.5

Tc00.1047053509835.30F CGCGGCACTAGTATGTATTCATGTTTGTCGCTGAGGC
Rint GCAGCAACGGCAACAAAGAGC324
R CATGGCAAGCTTTTAGTGA TGGTGGTGGTGATGCTCCTCTCTGGGTTTCCTTCG203171.6

Tc00.1047053509999.10F CGCGCCACTAGTATGTACGTCGTGCTTTTTTTCGTTT
Rint CGCATATTTCCGCTCCGTTCC305
R AGCAGTCCAAGCTTTTAGTGAT GGTGATGATGATGGCCGCACCAGCGCTCCAGAA122746.6

Tc00.1047053506563.4 0 ( 𝐜 ) F GGGTGCCACTAGTATGCGTGAGATTGTGTGCGTTCAG49.6
Rint GGGCGGAAGATCTGCCCGTATG259
R AGCGCTCAAGCTTTTAGTGATG GTGGTGGTGATGGTACTGCTCCTCCTCGTCGAACT1329

F: Forward primer including the start codon; Rint: Internal reverse primer for RT-PCR; R: Reverse primer used for the amplification of the full-length ORF.
( a ) Restriction sites used for cloning in the pTEX vector in italics and the His-Tag sequence in bold.
( b ) Expected molecular weight of the proteins (deduced from amino acid sequences).
( c ) Beta-tubulin gene.