Table 3: Gene ID of L. infantum orthologous genes and primers used for cloning.

Gene ID Primer sequences ( a ) F/R product sizes (bp)MW(kDa) ( b )

LinJ19.0410 ( c ) F CATGACCACTAGTATGGCCAAAACAGCGCTTCTC159058,4
R GCAGTCCAAGCTTTTAGTGATGGTGATGATGATGAGGTGTTCTCAGGGGTGACGA

LinJ36.5780 ( d ) F CATGCTCGACTAGTATGGGGTGCCGCAGTAGCTG
R GCAGTCCAAGCTTTTAATGATGATGGTGGTGATGATCATCCAACATCTGGCACCGC73828

F: Forward primer including the start codon; R: Reverse primer used for the amplification of the full-length ORF.
( a ) Restriction sites used for cloning in the pTEX vector in italics and the His-Tag sequence in bold.
( b ) Expected molecular weight of the proteins.
( c ) Ortholog of LmjF19.0540 and Tc00.1047053505789.10.
( d ) Ortholog of LmjF36.5220 and Tc00.1047053506155.99.