Table 2: Sequence and characteristics of PCR Primers.

Gene (Accession ID)Primer sequence ( 5 to 3 )Annealing TmProduct length (bp)

Lcn2 (NM_005564)ForwardTCACCTCCGTCCTGTTTAGG 5 9 C 242
ReverseCGAAGTCAGCTCCTTGGTTC
𝛽 -actin (NM_001101)ForwardTTCTACAATGAGCTGCGTGTGG 5 9 C 119
ReverseGTGTTGAAGGTCTCAAACATGAT