Table 1: PCR primer sequences used for analysis of canine the CLN6 gene.

TargetForward primer/reverse primerAmplicon size (bp)

Exon 1CCGTTCGTGCTTCCCGCAAC/GGACGCGCGGTGGATGGAC288
Exon 2TCGAGTCCCCATACCTTTCTG/CACTGCTGGTAAGGGCTCTGTC245
Exon 3TTCTGGGCCTGGGTGAACAC/CTGCTTCCACTGGCCTCCATGA243
Exon 4GAGCCACGGCCTCCCTC/GACGGCCCGACCCACAA267
Exon 5TGGAGGCGCCCTGCTG/TGCGCGCTGCCCTCTAGT281
Exon 6CAGGACGGCTGGTGCAAG/CCAGGGCACGCACGTTT281
Exon 7 (5′)GTGGGTACAGCGAGGGATGCC/CCGGGTACTTCTTCCTGAGC285
Exon 7 (3′)CTTCGCTCTCACCCTCCTGCT/GCCGTGATGACCGCACA249