Table 1: The sequences for the primers of RT-PCR.

Gene namePrimer sequenceProduct length

HNF-3βForward: CAGCTACACACACGCCAAAC204 bp
Backward: GGCACCTTGAGAAAGCAGTC
AFPForward: TCGTATTCCAACAGGAGG173 bp
Backward: AGGCTTTTGCTTCACCAG
ALBForward: GCTACGGCACAGTGCTTG260 bp
Backward: CAGGATTGCAGACAGATAGTC
TTRForward: CTCACCACAGATGAGAAG225 bp
Backward: GGCTGAGTCTCTCAATTC
AATForward: AATGGAAGAAGCCATTCGAT484 bp
Backward: AAGACTGTAGCTGCTGCAGC
TATForward: ACCTTCAATCCCATCCGA206 bp
Backward: TCCCGACTGGATAGGTAG
GAPDHForward: CTCATGACCACAGTCCATGC155 bp
Backward: TTCAGCTCTGGGATGACCTT

Abbreviations: hepatocyte nuclear factor-3β: HNF-3β; α-fetoprotein: AFP; albumin: ALB; Transthyretin: TTR; α-antitrypsin: AAT; tyrosine-aminotransferase: TAT; glyceraldehyde-3-phosphate dehydrogenase: GAPDH.