Table 3: Oligonucleotide probes used in this study.

Spot identifierTargeted GT geneSpecificityProbe sequence (5′–3′)

1wchBSerotype1 ATAAGATTATTGAGAAAATATAGACCGGATGTAGTCTTGACATATACCGTGAAACCAAAT
2wchBSerotype1 TTTATTGGTAGGATATTAAAAGAAAAAGGTATAGATACTTATCTGGCTGCTGCCCAAATT
3wchBSerotype1 GAAAATGAAAAACGAAAAGAGATGGGACTTCAAGGGAGAATGTATATAGAGCAATATTTT
4wchDSerotype1 TTATTGAAGGAATGATTGATAGCGACTTAATAGTTGTTCGTATTCCGTCTATAATTGGAT
5wchDSerotype1 GCCATAGATTTGTATTGGAAGCAATGAAGAGATTAGAAATACAAGGTATTTTGTTGGATT
6wchDSerotype1 AGCGATTGCGGGATCTATTATAGATTTTATTAGTATGGATAAGGAAAAGATGGTGATAAA
7wchFSerotype2, 21, 22F, 22A,23B, 32F, 32A TTTGTTGAGAAATTAACAGAATATCAAAAAGATGGTAACATCCAATACTATGTTGCCTGC
8wchFSerotype2, 21, 22F, 22A, 27, 32F, 32A CTAAAAAAGACTTTGTTCTCATTACAAATGTGGAACAGAATAAGTTTTACGATCAGTTGC
9wchFSerotype2 TTATTGAAGCAGTGGAGCAATTTGATGAGAACGCCATTTCTGAACTAGATAAAAAATCTA
10wchGSerotype2 GCAATACCAAGAAAAATACCCTAAAAAAATTAAGGTTATCACAGATTCCTCTGTTATAGG
11wchGSerotype2 TAGAAGTTTAAACAATCTGTTAGATTTGAATAGTAATGCAGTAGCTATGCATGATTGGTG
12wchGSerotype2 TTATCAGAATTCTCTAAGTAATGAGGAGACAGATATTATTCGTGAATTTATCAGCATTCC
13wchHSerotype2 TAGAAACCAGACAATTTTTTATCGGATAAAAGCTTCTTTGGGGAATACTCTAAAAAACG
14wchHSerotype2 CGTATTCCAGAAAAGTTACCTGATACCTATAATGTGTTGATTAATCCTGAAAGAGAAAAA
15wchHSerotype2 CTTTGTTGGAACTCTCAAATGGTCAGAATACTATAGTTGTAGAAGAGTTATCAGAAATAT
16wchISerotype2 CATTTTACCAGAACATGGAAATGTGGAAGATGAGCTTGTAAACAAAGGAATTAAATACTA
17wchISerotype2 TGATTTAGTTAGAGCGATAGCTAATCTTCCTGAGAGATATAAACAGATGTTTAAAGTTGA
18wchISerotype2 TACAAAAGAGATAATTTCTACAGGAGAAACAGGATATCTGTATGAACCAGGAGATTATAT
19wchESerotype3 TATAAGTCCTACAGTTGTAGTGTAAGTGATGAGAAGTTATTTAGTTCTGTAATTATCCCT
20wchESerotype3 ACTTTAAAAAAAGGCTATAAAACTGTTATGCAGGATACTTCTGTTGTGTATACAGATGCT
21wchESerotype3 ACTGCAATTGTTTATACAGCTTCATGGTGGGAAATTATTTTATATGTTCTTTTGGGAATG
22wciJSerotype4, 45 GATTGTTGAATTATTTTAGCTTTGCAATTAGTTCTACTTTAGGAGTTTTATTGGGGAGGT
23wciJSerotype4, 5, 45 GCCACAATATGCAGAAGATCTTTTTATCCCTGATGAATCTATAGTTAATAAAGAAAGTGT
24wciJSerotype4, 5, 45 CCTTCTATAAAAAATCAGATGCTATGTTAGTTTCTTTAATAGGAGACTCGATAGTTTCTC
25wciKSerotype4 GGTTCAGAAACAATTGGTGAAAAATTCTTTAATGAATATCGTTTCTTCAGACGGCTATAA
26wciKSerotype4 TCGATTTCAGTTGAATTTTATAGGTACTAATGCAGGAGAATTAAGGGAATTTTGTCAAGA
27wciKSerotype4 GTGAAGATACTTATATGGAAAAAGTGTCAATAGAGAATGGTTTTGGTTTCGTTTTACCTA
28wciLSerotype4 AAAAGCCTCTACATCAGTTTCTCTCTCTTGCTAGAATAATAAAGAAAGGAGATTATGATA
29wciLSerotype4 AGAACTCATTTTAATCAAACCAAATGTTATTTTACTCCTAGTTGGTAATGGTGAGGATGA
30wciLSerotype4 AAAAACATTAGTTACTTACCTATCAACGAAGAGTCTGTGTTGCTATGGAAAGATAAAGTA
31wciJSerotype5 TTACATAGGATATTAAATTATTTTAGTTTTGCTATCAGTTCCTCGATAGGGGTTCTACTG
32whaCSerotype5 TTTCTGACTCTCACAAGTATGATGGATTGGTATTACCAAAGAAAAATACAGTTCGCAATT
33whaCSerotype5 TATATCCCGAACCTCAACTTTTGAACCTTTTAACGAGAAATATCATATCCGTCAGATTAT
34whaCSerotype5 GAAGACTAAACTTCAGCGTGAATTGAAACTAGAAGAAGCACGCTATAAAGGAAATAGATT
35whaDSerotype5 AAGACGGCAGTACGCTATTTCTGTTGATGGTATAATAAATCATAGTAATATCTCACTTAA
36whaDSerotype5 GTTTTCACAAGATATAGTATTCGAAAATCTGAGAAAAATCTGCTTTTTGTGGGACAGTTT
37whaDSerotype5 TCTAATATACATATAATTCCTTTTCTAGAAAAAACTGATATCCTAGAGTTGATGCGGGTG
38wciNSerotype6A, 6B, 33D AATAGATTATCAAAACAATTTGCGCAGAGAGAAATTAATTGGATAGAGAACGTTGAGATC
39wciNSerotype6A, 6B, 33D TTACAAGGAGATTTAGGGGTTTTAAATGCAGTTTTATATAACTCATTTGGTGTACTTCCT
40wciNSerotype6A, 6B GCAAGAAGGCAGTAATGTTGCACATATAGACCAATTTAAAAAATACTATGAAGGTAGTTA
41wciPSerotype6A, 6B GGACACTTTTTATTAGGGATGATGGATCAAAAGATAAAACAATAGAAGTAATACAGAGGT
42wciPSerotype6A, 6B CAGGTTTTAATCATGCATTGCTAGAGATGGTTCCTTCAGTTGATATTGATAAAGATTATT
43wciPSerotype6A, 6B CTTACACATGCTGGGGTATATAATCAAACTCTTTATATGCTAAAAAAAGCTTCTGGAAAA
44wchFSerotype7F, 7A ATACAATACTATGTTGCTTGTATGCGTGAAAATTCAGCTAAATCTGGCATCATGGATGAT
45wchFSerotype7F, 7A AAAAATATATCCAAGAGGATTATAAGCAGTACCAACCAAAGACCACCTATATTGCCTATG
46wchFSerotype7F, 7A, 23B TTGTTACAGGATACTGGTTTTGATAAAGATCCTAGGGTTAAATTTGTTGGGACTGTCTAT
47wcwASerotype7F, 7A AAGTGCATCTTTCCAACGTCAAAAAGAATTCTTTTCGTTGGAAAGTTATATTCGGAATTT
48wcwASerotype7F, 7A, 21, 22F, 22A GTGTGTTGGATTATCCGATTTTACGTAGAAAATACTTTAATCCTAAGGGGATTTTAGAAT
49wcwASerotype7F, 7A, 21, 22F, 22A CTCACAAATCAAACGAATTGACTATTATGAGCATACGACTGAGCTTTATAATATGTTTGA
50wcwFSerotype7F, 7A AAATATGAAGTTATTCTAGTAAATGATGGCAGTACAGATGCTTCACCCAATATTTGTGAA
51wcwFSerotype7F, 7A TATTTTATTGGGAATGATGCGGCTATTACCAAACAGTGGTCTGAAAAAAAAATTAGTGAT
52wcwFSerotype7F, 7A ATGAAATTGTATGAAGAAAATCAGGAAGACACTCAACTTTTTAGGTTGATACTTGCAGAA
53wcwGSerotype7F, 7A AAAACGATTACCCGGATTTTTATTCCATAATTGGTGGTTAGAAGAATGGTCTAGAAAATT
54wcwGSerotype7F, 7A GGTGCAGATAAAGGAAGATTGCCAAAATTAAAAAGCTTAGCTAAGCAGATAGTTTTAAAT
55wcwGSerotype7F, 7A ATAAAAAGGGACAGGATGGTCTAACCCTTAGAGCAATGGAATCCATTTTTTATAAAAAAA
56wcwHSerotype7F, 7A GGAACAGAGTTACTAAGAATTGTAAAATCAAATCAATTGTAGGCAATATACGTGGCAAAA
57wcwHSerotype7F, 7A ATTTGCTAAATCCTATAGAGAAACGAAACCCATTTCATCTAGGTATGTTATATCATGAAG
58wcwHSerotype7F, 7A TATTTGAATATGCAATTGATGGCGAGAATGCACTTTTATCTCCGATAAAAGATAGTGTTA
59wciOSerotype8 AACTAATGAAGCTTGAACCGATTATGAGACAACAAGACAGCTATTTAATCACAGAATATA
60wciOSerotype8 AAATCACTTTATATACTGTTAAGAATACGCCCAAAAGTAGTTATCTGTACAGGTGTTCTT
61wciOSerotype8 TTTATATTGAATCTTTTGCAAAAGTGACCACTCCTACTTTAACAGGTAGAATACTATACC
62wciRSerotype8 AAAATAGATCAACTTATTGAATTAGAAGTGATAAAGGAAGAGGTGTTTGCTCAGATTGGA
63wciRSerotype8 TAAAGCTTTGAAATTAAGAAAAAAAATTATAGCGGTTCCACGATTAGAGCAGTTTGGAGA
64wciRSerotype8 ATGCTTTGATATAGAGCAGTTAGGAACTGTTTATCAAAAAGCTCAGACTTTTACAACAAA
65wciSSerotype8 TTTATTGATGGCTCTCTTGTAACACGGTTAACCTATTCTAGTTATGCTCTTCTTAAATTT
66wciSSerotype8 AACAACTTTCTTTTTTTAGGAAGGATGGGCAAAAGAAAAGGAGCCTATGATTTAATAGAT
67wciSSerotype8 AGGATAATGGCTGGTTAATTCAACCGGGTGATATTTCTCAGTTATCTAATATTATTTTAG
68wciTSerotype8 ATGGAATGAGGATAATTTTGATTTATCAGATTCACAATTTGCGAAGTCTGCATATGAATC
69wciTSerotype8 GGTGCAATATTATGAGCAAGCAAGTTTTGATATCAATCATTTGGTAACTGTCAATACAAT
70wciTSerotype8 AATAATTGATGGATTAGCAATTTATCCAGATGATTACTTTTGTGGTTATGATCAGGAGGT
71wchOSerotype9A, 9V, 9L, 9N, 19A ATTAACGATGAAAGAAACAGTGGATGCTGTTGAACAGTATGTTTTAAAGAAGCATCCTTT
72wchOSerotype9A, 9V, 9L, 9N, 19F, 19B, 19C TTTTGATGTATTATCAGGACACATTAAACGAGCTCCATTATGGATGCAAAAATTGAATCT
73wchOSerotype9A, 9V, 9L, 9N, 19A GAAAGAATATATTATCCAATCATTCATGGATAATGGAATTAATGCTGTGTTTATGGGGGT
74wchOSerotype9A, 9V, 9L, 9N, 19A GAGTAGCGGGTATTGATTTGATGCAATGTCTTTTAGAGTTGTCAAATAAAAAAGGATATT
75wcjASerotype9A, 9V, 9L, 9N AACAGGTGGACTATGGGAGAGCAAACTTTTATCAAAAGGAGTTCAACATCATAAAATTTT
76wcjASerotype9A, 9V, 9L, 9N TTAAAAAAAGCGTATTGTGTAGCTGTGGGTAAAGCGGTTAATGATAATTTGAAACATGAT
77wcjASerotype9A, 9V, 9L, 9N GTTGTTGAATGTATCAATAGTTTTGATTACTTAGTGTCATCATCTTTATATGAGGGGTTG
78wcjBSerotype9A, 9V, 9L, 9N GAAAAGGCTAATTTAGAAAATGAACTAATTGTTTCGTTTACAACAATTCCAAGCCGTCTT
79wcjBSerotype9L, 9N AGTTGTTCTAGTTGATGACGATATCATTTATCCTCGAAATACTATAAAGAAACTGATTGC
80wcjBSerotype9L, 9N CAATCCTGAGGAGAGTTTGGTATATTTGAATACCGTATATGATAACAACAATGATAAATG
81wcjCSerotype9A, 9V, 9L, 9N AAATTTCTAGCTGAACAACTTGTAAAAGAAGGACATGAGGTATTTGCATACTCTGATGAT
82wcjCSerotype9A, 9V, 9L, 9N TTATCAATAAAGGATTTATTAACCCATCTTCTCAAAAATGTATGGCCATTGAAAATGCTG
83wcjCSerotype9A, 9V, 9L, 9N CGAAAGTGATCCTAGAATACAATATTTAGGCTTTCAAGATACAAAAAACCTCTATGAAAC
84wcjBSerotype9A, 9V ATTGTAATTTTGGTTGATGATGACACTGTCTATTCATCGAATACCATCGAAAAGTTAGTT
85wcjBSerotype9A, 9V ACCCTGAAGAGAGTTTGGTGTATCTGAATGCTATATATGATAATAATAATGATAGGTGTA
86wciBSerotype10F, 10A, 10B, 10C, 47A ATCAAGGTAATCATATCTCACACCTCAATCCTTATTATTGTGAATTGACAGGATTATACT
87wciBSerotype10F, 10A, 10B, 10C, 31, 47A TTTAGATGTAACGCGAGAAATTATAAAAGAGGTTTCGCCAGAATATTTAGCAACATTTGA
88wciBSerotype10F, 10A, 10B, 10C, 47A TGAATTTATTTGAGAAGGGCAAATCCTTCTTGAAAGCCAAGTATTTCGGAAAAAAATATG
89wcrCSerotype10A, 10C, 34, 35F, 43, 47F, 47A GTTGCTGTATCTTTGGCAAACGAACTTACAAAAAAGTATGAAGTTCATTTGATTGGAATT
90wcrCSerotype10A, 10C TAACTGTTGGTCGTTTTGATTATCAAAAAGGATATGATTATCTTATCCAAGTCGCGAAAA
91wcrCSerotype10A, 10C TGGTTATCTGATAGATTGTTATGATACCGATAAGATGAGTGAGAAATTGCTTGAATTGAT
92wcrDSerotype10A, 10B GGATATGGTTCTTACGGATTTTACAGAACAACATGTTTATAACAATACTACTGTTCGAAA
93wcrDSerotype10A, 10B ACCTATAGAACATCTATCCTAGTCGACAATAGAATTCGTTTAAGTGAAAAGACGTTTTAT
94wcrDSerotype10A, 10B TATCAGAAGAATTATACAGACAAATTGAGCAGAGTTCTTATGAGTATATCCCTACGAAAA
95wciFSerotype10A, 10B AAGCATCATCAGATTGGATTTTCTTTCTAGATCCAGATGATTATTTGGAAGATTATACTC
96wciFSerotype10A, 10B GGATAAAATTGTGATTAGTCCACTTGAAACATATAACTATTACCGTAGAGAAGGTAGTAT
97wciFSerotype10A, 10B AGGCTGACTCTGGTTTAACAGATTTTTCGAAAGATCGAAACCTATTAAAAGTTGATTTTA
98wcrGSerotype10A, 10B CTCTGTTGGATTATAAGGAACATGATATTTTTATTATTGTAGGCAGCAAAGTTAATGTGG
99wcrGSerotype10A, 10B GCTAGAAATATTCAGAACAAATATGTTCGTAAATTTGTAGCATATTACCGTAAGCTAGAG
100wcrGSerotype10A, 10B GCATCTAACTGGGTATCTATTAATCAGGATTTAGTTAGAATAATACTAGAAGAAGAGAAA
101wchKSerotype11A, 11B, 11C, 11D, 14, 15F, 15A GATAGATTAAAAGGTGAGGGATTTATTCAGGATGATGTTTTTATTCAGACTGGTTTTTCA
102wchKSerotype11A, 11D TTCTTATGATGAGATGAATCGCTATATAGATGAAGCAAATATTATCATTACACATGGCGG
103wchKSerotype11F, 11A, 11D CGAAGGGTATGAATTATCTCTGATTAATGATATAAGCGAATTGCAGTATAGTTTAAAGCA
104wcyKSerotype11F, 11A, 11D CATCATAAATTAGATAAACTACTACGACCGATATTTTATCGAGTTTATACTCAGGCATGT
105wcyKSerotype11F, 11A, 11D CTAGGTCATGTTGGACGTTTTAATACTCAAAAAAATCAATGTTTTCTAGTGTCTCTAATG
106wcyKSerotype11F, 11A, 11D GGTCAATTTGATGATATGAAATCTTTTGTGTCATCAATGGATATAATGTTGCTTCCAAGT
107wcrLSerotype11F, 11A, 11D TGTATTGAAAATCAAAATCAATTTGTGCAGGATGCATATAGAGATAAAGCATGGGCTTTT
108wcrLSerotype11F, 11A, 11D GTTATGTCCTGAATTAAATACACCTGTATTTAAACGTCTTGGTTATACTTATTCTGACTG
109wcrLSerotype11F, 11A, 11D CAGATAAAACATTCTCTATTCATCATTATAGTGCTTCTTGGACTTCCTTAAGAAATCAGA
110wciJSerotype12F, 12A, 12B, 44, 46 GGAAATATATGCTGATTATCGTAAGAGAAAAAAAAGAAGAGAGACTATAAATGGTGTTGC
111wciJSerotype12F, 12A, 12B, 44, 46 ACTTAACTTTTGCTGGAAATATTGGAAAAGCTCAGAATTTAGAGACTATTTTGAAAGCAG
112wciJSerotype12F, 12A, 12B, 44, 46 AATGTTGATCAGTTAGTGAGAAATATTCGTAAGTTCTGTTTGCTTTCTGTAGAGGAAAGA
113wcxBSerotype12F, 12A, 12B, 44, 46 ATGTTCCGAAACAATTTCAACAGTATGCAGTGAAAATTGGTACAAAGTCTGATATTCGTT
114wcxBSerotype12F, 12A, 12B, 44, 46 AAAAGAATATCCAGTGAAAGTAATTCATAATGGTATTGATACTACTGTCTTTCAACCGAG
115wcxBSerotype12F, 12A, 12B, 44, 46 TAGAAAGTGCTAAACTTTATGGTCTCGTTTGTCAGGATAGAAACGTAGCTTCTATTTTAT
116wcxDSerotype12F, 12A, 12B, 44, 46 GAAGAAGAATTTTTTTAAAGTTAGTGGAGCTTTGCGAAAAGTGTTGAAAAAACAGCAGTT
117wcxDSerotype12F, 12A, 12B, 44, 46 TGTCAGCTCTCTTCTAAAAAAATTATCAGTGTTGGATCTTTAGTACGACAAAAAGGTTTT
118wcxDSerotype12F, 12A, 12B, 44, 46 GATAGAGAAAAATTAGAGGAGAAAGTCAGGGAATACCAATTAGAAGGCTTTATAAATTTG
119wcxESerotype12F, 12A, 12B, 44, 46 ATAAAATCCCCGATAATCTTACCCAATTTTTTGGACGAGAAAATATAGAAGAGAGAGATA
120wcxESerotype12F, 12A, 12B, 44, 46 TATAAAACCTTGATTACTCCCATTTTGATAAAAGAACAGATACCAATTATTCGGACGCAA
121wcxESerotype12F, 12A, 12B, 44, 46 AGGTAGCAGATTTTGCTTTATTTCCTAAACAATGTAGTTTAAGTTTTTATGATGCACAGG
122wcxFSerotype12F, 12A, 12B, 44, 46 AAGTTACAATGAGAAATATAATCATGATGAAATTACGGTCGTTAGTTGTGACCATAAGGA
123wcxFSerotype12F, 12A, 12B, 44, 46 TGATTGTTTTTTTTGGACGTATCAACAAAAATAAAGGTATCAAAGAACTGCTTGAAGCCT
124wcxFSerotype12F, 12A, 12B, 44, 46 GAAATGCTCTTCGGTTATTACTTCTAATAGAGATAGAGGAGCCTATTTTTCTATTGAAAA
125wchKSerotype13, 14, 15B, 15C CTTATGAAAAAATGAATCAATTGATTAAGGAATCAGATATTATCATTACCCATGGCGGTC
126wchKSerotype14 TAAAAATCCAATAATTGTTCCGCGGCTAAAAAAATTTGGTGAGCATGTAAATGATCACCA
127wchKSerotype14 AGGACAAACATTTTGAAACTTATTTGAATAACGAGAGATTTAATGTACGTTTCAATGTGG
128wchLSerotype14, 15B, 15C TTGTGTTGATAGTGCCTTAAAGCAAAATTTAGAATCTCTTGAAGTGATTTTGGTGAATGA
129wchLSerotype14, 15F, 15A AAAAATTCTTGAACAGTATGGTGATAATCCCCAAGTGATGATTTTCCATCAAGTGAACAT
130wchLSerotype14 GCTAAGTTATTTCTTCGTAGAAGAATTGAGGAAAACAATATTGCTTTTTCGACTGAAATG
131wchLSerotype14, 15F, 15A, 15B, 15C TCCTAAAATTGAGGAGAACTACTACAAGCAACATATGGATTTTAGATTTTATCTTGCTAG
132wchMSerotype14 AATAGAAAGTATTTTGAATCAAACGTATGATAACCTTGAGGTTCTATTAGTCGATGATGG
133wchMSerotype14 AATAGAAAGTATTTTGAATCAAACGTATGATAACCTTGAGGTTCTATTAGTCGATGATGG
134wchMSerotype14 CAGTATTGTAACTGGATTGTTACAATAACTGTTAGTCATTACAATGTTTTGAATGTAGCC
135wchNSerotype14, 15F, 15A, 15B, 15C CAAAAAAATGATATGAACATTTCGAATAAAGTTTGGATTTGTTGGTTTCAGGGCGAAGAA
136wchNSerotype14 TATGCGAGAAAACTACTCTGGGAGTATTGGCGTAGAAAAAATAGTTTATGCAATTATTTT
137wchNSerotype14 GAGTTAAATAATCAATTTTCAGAAAAAAGGTGGGAACAGCTAAAACAGATATCGGTGTTT
138wchKSerotype13, 15B, 15C GATGAAGTATTTATTCAAATAGGATATTCCAGTTATATTCCGAAATATTGTGAGTGGGAA
139wchKSerotype15B, 15C GCATGTGAATGACCATCAGCTTCAATTCGTAAAACTGACGAAAGAAATATACAATTTTAT
140wchLSerotype15B, 15C AGAAATTTTGAACCAGTACGACAGGAATTCAAGGGTTAAGATTTTTCATCAGCTTAATAA
141wchLSerotype15F, 15A, 15B, 15C GAAGAAAATAATATTACTTTTTCGACTGAGATGTCACTAGGTGAAGATATGTCATTTGTG
142wchMSerotype15F, 15A, 15B, 15C GAAAGTATTTTGAATCAGACTTATCAAAATATCGAGATTTTATTGGTTGATGACGGAAGC
143wchMSerotype15F, 15A, 15B, 15C GTACTGCAATTGGATTGTTACAGCGACTACCAATCATAGTAAGATTTTAAATCCTAATTT
144wchFSerotype7B, 16F, 17F, 18F, 18A, 18B, 18C, 23F, 23A, 24F, 24A, 24B, 28F, 28A, 40, 48 GAAACTTTTGTTGAAAAATTAACAGCCTTCCAACAAGATAAGGCTATCCAATATTATGTG
145wchFSerotype16F, 17F, 18F, 18A, 18B, 18C, 23F, 24F, 24A, 24B, 28F, 28A, 48 AAGGTCTTATGGTCAAACATGCAGCTCTTTTAGTGTGTGATAGTAAGAATATTGAAAAAT
146wchFSerotype16F, 17F, 18F, 18B, 18C, 23A TTCGTTACTTGAAGCATTAGCATCCACAAAGTTAAACTTACTACTCGATGTTGGTTTTAA
147abp1Serotype17F, 24F, 24A, 24B, 48 GCCAGTCATTATCTATACCCTTGAAAAATTTCAAAATCATCCAGAAATTGATGAAATCTG
148abp1Serotype17F, 24F, 24A, 24B, 48 ACACAAACTCCTCATGTTTACCATCTTGATAATATTCTATCGCTTCATGAAAAAGCATTA
149abp1Serotype17F, 24F, 24A, 24B, 48 TTATTTCTCTCTTGGAACAGAGAAAAACTTGAAAATTACGACTGTAGAAGATCTCGATAT
150wciPSerotype17F GAAGAAAAAGATAGACGGATTAAATTGATTGAAAACATATCGGAATATCATGGAGCCTAT
151wciPSerotype17F GTATACCAATCCTATCTCAACTTTTATGGCTCATAAGGTTTATGGATGTAATACGTTATT
152wciPSerotype17F ATCTTAAAACGTATCTCGAAAATTGATGAATTAGCTAAAGATCATGCCTTGACTTACAAG
153wcrVSerotype17F TCGACAGATAGTAGCAAACAGATAATTAACGAGTATCTTAATGCAGACAGTAGATTTAAA
154wcrVSerotype17F CATGCAAAACTTAAGTTGTTCTGTCAGAATTTTAAGTTAGTGAGGAAACAGATTTTTAGG
155wcrVSerotype17F CGATTTAATCTACTAAAAAATAACGGAGGAATGTGGGTTGACTCCACTATATATTTTACT
156wchFSerotype7B, 16F, 17F, 18F, 18A, 18B, 18C, 23F, 23A, 24F, 24A, 24B, 28F, 28A, 40, 48 TATAGCGTATGATATCGCTGCAATTAACAGAGCTATTGAAATTGCCAAAGAAAATAAGGA
157wchFSerotype16F, 18F, 18B, 18C TATAATCAGCTATTAGCAAGTACTGGATTTGATAAAGATCCACGAGTGAAATTTGTTGGA
158wciUSerotype16F, 18F, 18A, 18B, 18C, 28F, 28A AGAAAAAGTACAACCCGACATTATACATATTCACTCGTTTATGGGATTGCATAAAGAATT
159wciUSerotype16F, 18F, 18B, 18C, 28F, 28A TCATCATCAGAGATTGACAACTGCAAATAATAAAATTAGAGTTGCTTATATTGGTCCAGA
160wciUSerotype18A, 18B, 18C GACAAGGAAGATTTGTTGGCTAAAATCATCAATAATCAGTTGAAGAAAATTCCGCTTAAA
161wciVSerotype18A, 18B, 18C AAATACATAACCTTTGTAGATTCAGATGACTATGTTTCTCTAGATATGCTGCAAACTCTA
162wciVSerotype18F, 18A, 18B, 18C AGAAGATGCTATTTTTCAAATTGATTGTTTAAAATTAGCAACATCTGCCCTTGTTATCCC
163wciVSerotype18F, 18B, 18C ACCCAATATCAAAATCAGTATTACGTCATTATCCAATCCATCGTTTACCTTTTACTAAAC
164wciWSerotype18F, 18A, 18B, 18C AAGTGCAACTTGAAGATAGGGCCTACAGAATACTAAAAAAGAAATACGGTTCTTTAATTT
165wciWSerotype18F, 18A, 18B, 18C TGGATTGACTCAACAGTGTATTGTACAGGAATTACTACCATAGAGACAATTGAAAAAAAT
166wciWSerotype18F, 18A, 18B, 18C TACGAACGCAACACCACATATAATGGTTGATGAATTAAATAATGTTTTTTCAAAGGAACG
167wchOSerotype19F, 19B, 19C ATAGATAGTGTAGAACAATATGTATTAGAAAAAAGACCACTACACTTGATGGGGGTGAAT
168wchOSerotype19F, 19B, 19C GCTCAAAGTATTTAAGAGAGATTATCCAAATTTGATAGTTATTGGACACAGAAATGGCTA
169wchOSerotype19F, 19A, 19B, 19C AATTTAGAGTGGTTATTCCGTGTAGCTAATGAGCCTAAACGTCTCTTTAAACGTTATTTT
170wchOSerotype19A GAGTTGCTGGAATAGACTTGATGAAACATTTACTAGAGTTGTCTAATGAAAAAGGATACT
171wchQSerotype19F, 19A, 19B, 19C ATCAGATTTAGAAATTGATGTTTTGATTAACCATGAAAATGCTGGTTTTGCTCGTGGAAA
172wchQSerotype19F, 19A, 19B, 19C ATCAGTAGACTATAGAAAACAGGTAGAAAACCCAATTCTTCATGGTTCTTTTATTGTATA
173wchQSerotype19F, 19A GGATACAAGAGAATTTATACACCTAAAATTAGAGTTTTGCACCATCAAAATGTTGCAACT
174wciBSerotype20 ATACTGGGGAAAACATTTCCCAGTTAAACCCTTATTACTGTGAATTAACAGGTTTATATT
175wciBSerotype20 AAAAAGGAAATATTATATTGAAACTCTATGTTCTCATTATGCACACACGCTAGATGCTAG
176wciBSerotype20 AATGGCTGTTTCCGATTTTAGATTGTATGTTTGATCAGATTAATCTTTCAGAGTTAACTG
177whaJSerotype20 TTTCTCAAAAATTAGCGACCGAAAACTCAAATATACGAGTCTTGAAATCAGATAAAGGAA
178whaJSerotype20 GATTGATGAGTACGGTTTGAAGTTTAATACGAATTTGAGAGTTTCAGAAGATAGTGATTT
179whaJSerotype20 CTATGTTTTTTGAGCCTATACAAAATCTATCTGTATCTAGTGTTAGCAATTTATCGCTAG
180wciLSerotype20 GATACGTTATTATTGGGAAATGTATAGATTCTTCAAAGAATATGCATCTGATTATCAGGC
181wciLSerotype20 TATACATTAGACAATAAATTTGTGCTAGGTCATGTAGGACGTTTGCATTTTCAGAAGAAT
182wciLSerotype20 GACACTACTCTCAGAAGAAGGTGTACCAAAGGAAGTAAAAATCAATGATAATACTTTTTT
183wcwKSerotype20 AAACAAGATATAGAGATATGGATTTGTTTCAATATTGGTTTCGAGCGGTAGAAAAACATG
184wcwKSerotype20 AATCTATTTAGCATTTTTTATTCAGGGATTATTGGTTATCATGATGCTCATGTCGCTATG
185wcwKSerotype20 GTGAATATGTGCCTCTGGCTTATTCAGGTAAAATTGAATCTATTATTCACAAACAAAAGA
186wciDSerotype20 TGGCTCAGAAACTGGAAAAAGAGTATTCTGGCATAGTTAGTATAATTGATAAAGAAAATG
187wciDSerotype20 CATAAAAATTGATGAGAATATGTTCTACGTTGACATGGAGTATATTGTTTTTCCAACTCC
188wciDSerotype20 GAGACAATTGCTAGATGTGTTACTATTATGACAAATGTTTGTCTATCAATGGAAGATACT
189whaFSerotype20 ACTTTAATACAAAAAACTGAATTTCCTAAATTTATCTGGACTATGTGGTGGCAAGGAGAA
190whaFSerotype20 ATTTGGTTAGATTCAACGATGTATGTCCATCCAGATTTCCCTATTGAAATATTAGAAAGA
191whaFSerotype20 AGGGAAATAATAAAAAGTATCCCTAGATATTCTAGTCAAGAAGACATCTTTTGGTTGAGA
192wchFSerotype22F, 22A ACTTATATCGCCTATGGAACAGATACAAGCAAGTCTATTTTAAAACCTGATGACGAAAAA
193wchFSerotype18F, 22F, 22A, 23F ATCGCTTTTAGAAGCTCTTGCTTCAACAAAGCTTAATTTACTGCTAGATGTTGGCTTTAA
194wcwASerotype22F, 22A TAAGAAGACAAGGAGAATCGTTTTCTTTGGAATCTTATATCCGTAGTTTCTCAGAATTAT
195wcwVSerotype22F, 22A GAAAAACGGGGAAAAAATTAAAGTATTTTGGAGAAGGGGAATAAGATTATTTAGAAGTGG
196wcwVSerotype22F, 22A GGAGAATAAGCAAAATATTCTTTATGTAGGCTCACTATCAAAAAGAAAAAACACAGCTCA
197wcwVSerotype22F, 22A ACCTTATTTAAAGAACTCTCAGCTTCAATTTATTTACCCATCATCACAACTATTTGTGCT
198whaBSerotype22F, 22A TGGCAGTATAGAAAGGGTAGAAGCCTTATTTGCAAATAATGACGAGATAGTTATAATAAA
199whaBSerotype22F, 22A CATCATCAAAGTCCTGTTGTTGAGAAGATCAATTCTATATCTAAGGCAAATAAAGAACTT
200whaBSerotype22F, 22A TTATTTTACATGGGAGTTGTGTAATTTTTTCACCATTATATGTTTCAGAGGAGGAGTTTG
201wchFSerotype23F, 23A CCATTTACTGGAAGAAAGATAATCTTCATGAGATTATTGAAACGAGTGAACAAAAAACAC
202wchVSerotype23F, 23A, 23B CCTCATTTTTGTTGACAGTGATGATTTTGTCTCTCAAGATATGGTATCTTATTTAGTATC
203wchVSerotype23F, 23A GGCCAAGATATTTAAAAGAGAGTTGTTTGATGATATAAGATTTCCTGTAGGTAAGCTATT
204wchVSerotype23F, 23A TTTTGGAGATTACGAACACAATTATTAATCACTATGGTGATAATTTACGCGTGTATACTG
205wchWSerotype23F, 23A ATTTGAAACAAAATTATCAAATAAACTTGGCCTACAAAAATCTTTGCATGGAAAGGGTGG
206wchWSerotype23F, 23A CGGGGGGATATTATACAAAAGAGTATAAACAACTATTCAGTTCGGTAGTAGAAAATATTA
207wchWSerotype23F, 23A CCTATAGAGTAAATCTCCATCAATTTTTAATAAACGAGATCTCAGATGCTACAGTAAGAT
208wciBSerotype33F, 33A, 34, 35A, 35B, 35C, 37, 41F, 41A, 42 TTGGTTTTATCGGTGATAATACTGGCGATAATATATCCTCTCTAAATCCATATTATTGTG
209wciBSerotype33F, 33A, 34, 35A, 35B, 35C, 37, 41F ATAGTTCCAAAGAAGCGAAAGTATTATATTGAAACTCTTTATTCACATTATGCCCATACC
210wciBSerotype33F, 33A, 34, 35A, 35B, 35C, 37, 41F AACTATTAGATGATTATTTACCGTGGCTTTTTTCTATTCTGGATACTATGTACGAACAGA
211wciCSerotype33F, 33A, 37 CAAATTTTAATATCTGATACAGATGTTTATTATTTTACTCCAGCTGGTTCAGTAGCTGGT
212wciCSerotype33F, 33A, 37 TTACGAAATTTTATTAGAAGTTGCTAAGAAGATGGTGGGGGATGAGAAATATCACTTTTA
213wciCSerotype33F, 33A, 37 GTTTTACCATCGTATTATAAAGATGAAACTTTACCTATCAGTATGTTAGAAGCAATGGCA
214wciDSerotype33F, 33A, 37 AATAGCAAGACAATTCGAGAGAGAATATGAGGGAATTGTTAGAGTTATAAGTAAGGAAAA
215wciDSerotype33F, 33A, 37 TGCAAGAGAACAATATTCGGCTGTCTGAAAAAATGTTCTATGTAGATATGGAATATATTG
216wciDSerotype33F, 33A, 37 GCATAAACAAGTGATCTATCATTTGGTTGATTTTTATAATCAAATGAGATCTAGCGCTGT
217wciESerotype33F, 33A, 37 GCCAATTTTTAAAATCCTATAACTTTAAAGAGGTATCGCACAAGGAGATAGAACAAAGAA
218wciESerotype33F, 33A, 37 CTGAATTATTTAAAAAAAGATTTTTATACTATTCGAGCAAAGACACATGAGAGAGTGCCC
219wciESerotype33F, 33A, 37 TAAAGTCGAAGAAAATAATCAGGAGTTGTTCTTTTTGGCAGACAATTTTTCTAACCAGTA
220wciFSerotype33F, 33A, 37 CTGGGGAAATATGTGATGAATATGGGAAACTGTATGATAATATTCATGTTTTCCATAAGA
221wciFSerotype33F, 33A, 37 CAGAGCGTTTGTTGAATATTAAAACAGTTGCTCATACCGATTTGCCTATATATCATTATT
222wciFSerotype33F, 33A, 37 AAGGAATTGTTAGCAGCCTTAAATGCTAAAAGAGTAATTGGCTCCTTTATTTTGAGTAAT
22316SStreptococcus pneumoniae TATTGGAAACGATAGCTAATACCGCATAAGAGTAGATGTTGCATGACATTTGCTTAAAAG
22416SStreptococcus pneumoniae ATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTAGGCTTTGGAAACTGTTTAACTT
225aroEStreptococcus pneumoniae ATTTCAAAAACGGTGTTTCAAAGGGTTGGTATATGATATCTGCAACTAAGAGAGTTTCTG
226aroEStreptococcus pneumoniae AGCAGGGTCATCTTTTTACCTGAAATTGTAAAAGAAGGCAAGCACTTAAAAAATCCCTTG
227aroEStreptococcus pneumoniae TCAAAGGCTCTATTGTGGATGAAGGGAGAAATAGAATGCTTAATAGGATTGGCAACAACT
228ddlStreptococcus pneumoniae TATTGAGCTCGTTGAGAAAAATCTCTCCCTTATCTGTATAGAAGAAATCGCAACGAGATA
229ddlStreptococcus pneumoniae ATGTTTGACGGCTTAGTGAAGACTGGATAAGCCAATTTTTCTTCCACTTCAGCGATTTTA
230ddlStreptococcus pneumoniae CATGACTAAATTCCTGTGTTTTGATAAAGTCACCTGACTGACTGATAAAGAAAGTCTTGA
231gdhAStreptococcus pneumoniae TGAATTCCTCCAAGCTGTTGAAGAATTTTTCAACACTTTGGAACCTGTATTTGAAAAACA
232gdhAStreptococcus pneumoniae TAAACCAAGGGATTTTGAAATTCCTCGGATTTGAACAAATCTTTAAAAACGTCTTGACTG
233gdhAStreptococcus pneumoniae TATACTGAAGAAATGCTCAAAGCTAACGGTAACAGCTTTGCTGGTAAGAAAGTGGTTATT
234gdhAStreptococcus pneumoniae ATGGACGTCTCAAAGACATCATGACCAACATCTTTAACACAGCTAAAACAACTTCAGAAA
235glcKStreptococcus pneumoniae AAATGGTCAATCAAGACCAACATTTTGGATGAGGGAAGTCATATCGTTGATGATATGATT
236glcKStreptococcus pneumoniae AACAAAAGATTGAAAAAGCTTTGGGCATTCCATTTTTCATCGATAATGATGCCAACGTAG
237glcKStreptococcus pneumoniae AGAATTCCTTCTACAAGGTGTTCAAAAAGTTTACGATGAAAATAGTTTCCCACAAGTACG
238spiStreptococcus pneumoniae AGAAGGTATTCTCCTTCTGGAACAGTAAAGCTAAAGTTGGTGTTGTAGTTGACATCAACT
239spiStreptococcus pneumoniae TGATATAGTCTGCTAGATAAGGCTCGTCCGTTTCTTTGTCATTGATGTAGAGTTTATCAT
240spiStreptococcus pneumoniae AACATTGCTCCAAAAAAAGATACGGCTCAAAGCTAGTAATGACAGAATCAGGAGGAATAA
241tktAStreptococcus pneumoniae ACAATTTTTACAAGATTTTCTACAGTAAAGCCATATTCTGCCAATACTTTTGGTGCTGGG
242tktAStreptococcus pneumoniae CAATCAAGATGGTATCAAAGTCGGCTGCATTTTCATATACAACATAAGCACCTTTAGCAA
243tktAStreptococcus pneumoniae TTCAAGATTGTTCCCATTGCAAATTCACGAACACCAAACTGAATGTTACGATTCAAGCGA
244tktAStreptococcus pneumoniae AACATGTTCTTTGAAATCAGCATATACTTGTTCTGGAATTTCAAATGGTTCGTAGTCCCA
245tktAStreptococcus pneumoniae TCTCCACAGATAACGTAAGTATAGTGGTCAAAGATATTGTAGCCTTCACGGTTATATTTG
246xptStreptococcus pneumoniae AGATTCCTTTTTAACCCACCAAGTTGACTTTAGCTTGATGCGAGAGATTGGTAAGGTTTT
247xptStreptococcus pneumoniae ATGATTTTCGCCAAAAAAGCTAAGAACATCACCATGAACGAAGGCATCTTAACTGCTCAA
248xptStreptococcus pneumoniae TTTGATTATCGACGATTTCCTTGCTAATGGCCAAGCTGCTAAAGGCTTGATTCAAATCAT
249KP_gapA Klebsiella pneumoniae GACGTTGTTGCTGAAGCAACCGGTATCTTCCTGACCGACGAAACCGCTCGTAAACACATC
250KP_rpoB Klebsiella pneumoniae AACGGTGTGGTTACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACTACGTT
251KP_mdh Klebsiella pneumoniae TGTACGATAAAAACAAACTGTTCGGCGTTACCACGCTGGACATCATCCGTTCCAATACCT
252KP_pgi Klebsiella pneumoniae CCTGGCCTTTGGTAAATCCCGCGAAGTGGTTGAGCAGGAATATCGCGATCAGGGTAAAGA
253SA_arcC Staphylococcus aureus TGATAGGCTATTGGTTGGAAACTGAAATCAATCGCATTTTAACTGAAATGAATAGTGATA
254SA_aroE Staphylococcus aureus AAGTTTTGATTGGTCATTAGTTCCTGGTTATATTGTTGCTCAAATGTTAGGTGCAATTGT
255SA_glpF Staphylococcus aureus TAAGAATTACTTTGCCAACTTTTTAAGTGAGATTATCGGAACAATGGCATTAACTTTAGG
256SA_gmk Staphylococcus aureus CGTAGATTACTTTTTTAAAACTAGGGATGCGTTTGAAGCTTTAATCAAAGATGACCAATT
257LP_acnF Legionella pneumophila CGAAAAAAAGGGGTTGTTGGTAAATTTGTTGAATTTTATGGTCCTGGACTTAATGATTTA
258LP_mompS Legionella pneumophila TCAATGTGAACTGGTATCATTTTGATAACGACAGTGATCACTGGTTTGATTTTGCTAACT
259CP_groES Chlamydophila pneumoniae TTCTTTACCTGCGTTACTTGCAATTTGCTTTAATGGAGCTGTTAATGCTTTTAGAATAAT
260CP_gyrA Chlamydophila pneumoniae GTTTGGTGGCTAAAAATAAGAAGCCGGCATTATCAAAATTCTTAATATTCAATATAGCTG
261CP_gyrB Chlamydophila pneumoniae CCAAGACCTTTATACCTCTGAATTTCTATGCCTTTTCTTCCAAGATTTTTAAGATAGTTA
262CP_dnaA Chlamydophila pneumoniae CCTGCTGCTTCTAAAACATCTTTTAAAAGAGTTTTCACATCATCTTCATATAGTAATTGG
263CP_accA Chlamydophila pneumoniae TGATAACAGTATCGATAATGCCAAATTGTTTTAAGTTTTCTCCATGCATTTTCAACATGG
264CP_dnaK Chlamydophila pneumoniae TCAAAAAACAAGAAGGCATTGATCTTAGCAAAGATAATATGGCCTTACAAAGACTTAAAG
265MP_gyrB Mycoplasma pneumoniae AGGAACCTTTATTTGAGGACATTATCTTTGGTGAAAAAACCGATACTGTTAAATCAGTTA
266MP_gyrA Mycoplasma pneumoniae ACAAGATCAAATTGACAAAATTCGTCAGGAATTAGCACAATCAGCAATTAAAAACATCTC
267MP_dnaJ Mycoplasma pneumoniae TTGCGCAAGCTCAAGGAATTTATTAAACCTAATCAAGAGGTAAAACAATATTTAAACGCA
268MP_lgt Mycoplasma pneumoniae TGGGATTGCCTTTGGCATCTTAATGTTTGTCTTGAAGTTAATTTACTTTTACAAGATTCA
269MP_fus Mycoplasma pneumoniae TAAGCTTCCGTGAAACCTTCAATAAAGAAAGTGAAGTTGAGGGTAAATACATTAAACAAT
270MP_lspA Mycoplasma pneumoniae TTTGAAGAACTGAATTAAAAAGGAGAGGAACAGACCAATAAAACTAAAGGTAATGCAACA
271PA_trpE Pseudomonas aeruginosa TCACCGAAAAAATGGTGATCGAACGTTACTCCAACGTCATGCACATCGTGTCCAACGTCA
272PA_nuoD Pseudomonas aeruginosa GATCATGATGGCGGAGTTCTTCCGTATCCTGAACCACCTGCTGTACCTGGGCACCTATAT
273SP_gki Streptococcus pyogenes ATTCAGCCATCAAAGCAGCTATTGACAATGGTGAAGGTGTTACCAGTAAAGACATTTTCA
274SP_xpt Streptococcus pyogenes ATCGCTGGTAAATTCCTATCTAAAGAAGACAAGGTTTTGATTATTGATGACTTTTTAGCT