Approaching Biomarkers of Membranous Nephropathy from a Murine Model to Human Disease

Table 2

PCR gene sequences in four candidate genes and housekeeping genes.

Name	Forward	Reverse	Product (bp)
Ly6e	5′agtcttcctgcctgtgctgttg3′	5′cgccacaccgagattgagattg3′	253
Lamr-1	5′ctcttatgtcaacctgcccacc3′	5′tgctcctccttctcaatctcctc3′	221
CtsD	5′agctgtcctacctgaacgtcac3′	5′tgtctttccaccctgcgatacc3′	287
Mt-1	5′tcaacgtcctgagtaccttctcc3′	5′tgaagacctctgcttcctgtcc3′	397
GAPDH	5′tccgccccttctgccgatc3′	5′cacggaaggccatgccagtga3′	354

Ly6e: lymphocyte antigen 6 complex, Lamr-1: laminin receptor-1 (67kDa), CtsD: cathepsin D, Mt-1: metallothionein-1, GAPDH: housekeeping gene, bp: base pair.