Table 1: The sequence of primers for quantitative real-time PCR.

GenesGene sequence (5′–3′)Fragment (bp)

MaterForward: GCTGGAGGCGTGTGGACTG; Reverse: GGTCTGTAGATTAGAGGTGGGATGC168
Zar1Forward: TGCCGAACATGCCAGAAG; Reverse: TCACAGGATAGGCGTTTGC168
Gdf9Forward: CCCCAGGATTACAAGGAAG; Reverse: CTGGATGTAACTCGACGTCTCT198
18sForward: GAGAAACGGCTACCACATC; Reverse: GCTATTGGAGCTGGAATTAC198