Table 1: Primer data.

GeneAccession numberFwd primer (5′–3′)Rev. primer (5′–3′)Amplicon sizePCR efficiency

arp (ref. gen)AY255630GAAAATCATCCAATTGCTGGATGCTTCCCACGCAAGGACAGA1011,813
ef1ab (ref. gene)BG933853TGCCCCTCCAGGATGTCTACCACGGCCCACAGGTACTG592,013
fatpCA373015/AF023258TGGGAGCTTGTGGGTTCAAACTTTCATGAGGCGGATTGG642,243
actbBG933897CCAAAGCCAACAGGGAGAAGAGGGACAACACTGCCTGGAT922,007
gstBQ036247ATTTTGGGACGGGCTGACACCTGGTGCTCTGCTCCAGTT812,07
tubaBT049768GAGCCAGCCAATCAGATGGTTGCGCTTGGTCTTGATTGTG1102,009
gpxBQ036408TTCTCCACCACACTGGGATCAGGAAATGGCATCAAGTGGAATT1012,011
hsp-70BG933934CCCCTGTCCCTGGCTATTGCACCAGGCTGGTTGTCTGAGT1211,895
cox2AJ238307CGTCCTGAGGCAGGAGCATTGAGGCGTGTGGTCTGGAA622,18
cpt1AM230810CTTTGGGAAGGGCCTGATCCATGGACGCCTCGTACGTTA1211,917
bcl-xNM_001141086GCCTGGACGCAGTGAAAGAGGGACGGCGTGATGTGTAGCT1072,127

Full gene names: acidic ribosomal protein (arp), elongation factor 1 alpha b (ef1ab), fatty acid transport protein (fatp), β-actin (actb), glutathione-s-transferase (gst), tubulin α (tuba), glutathione peroxidase (gpx), heat shock protein 70 (hsp-70), cyclooxygenase 2 (cox2), carnitine palmitoyltransferase 1 (cpt1), and B-cell lymphoma x (bcl-x).