Table 1: Type-specific primers for screening PERV-positive clones from NIH miniature pig BAC library.

GenePrimer sequence (5′ 3′)Annealing temperature (°C)PCR product (bp)

Env-AF: TCCGTGCTTACGGGTTTTAC60224
R: TTGCCAATCTTTCCATCTCC

Env-BF: TAAAAGCACACCTCCCAACC60192
R: CCGGAATTGACAAAGGAGAA

Env-CF: CACCTATACCAGCTCTGGAC56310
R: GTTAGAGGATGGTCCTGGTC