Table 2: PCR conditions and primer information for contig mapping of PERV positive clones.

Type of PERVBAC clone IDPrimer sequence (5′ 3′)Annealing temperature (°C)PCR product (bp)

A1-1F T7F: CCTGAGCGTGAAAAGATTCCR: GGCCACTTGATTATGGCAGT56298
SP6F:CCATGTAGAAGAGACACCTGTTGR:TGAAGGTCCTGAGGTGTATGG56290
A1-1E T7F:CCTGAGCGTGAAAAGATTCCR:GGCCACTTGATTATGGCAGT56298
SP6F:CCATGTAGAAGAGACACCTGTTGR:TGAAGGTCCTGAGGTGTATGG56290
A1-2G T7F: CCTGAGCGTGAAAAGATTCCR: GGCCACTTGATTATGGCAGT56298
SP6F:CCATGTAGAAGAGACACCTGTTGR: TGAAGGTCCTGAGGTGTATGG56290
A1-6C T7F: CCAATGATTCACTGACCTTTGAR: TCCCTAGAGGGCTTCCTTTC56214
SP6F: ACGTGGAGACGTGAAGAACCR: GACTCGAATCCAGCCTAAACC56111
AA1-6E T7F: TAGCATTTCCATCCCAAACCR:TTGCAGAGCAGATACTGACTCAC56105
SP6F: AGGTGGAAGCTACCTCAGCAR: GCAGAGCTCTTACGCAGTCA63186
A3-9FSP6F: TCATGTGCAGTTCATGGAAGR: TGGGAGTGGAGATTGTCCTT56183
A3-10ESP6F: TCATGTGCAGTTCATGGAAGR: TGGGAGTGGAGATTGTCCTT56183
A4-1G T7F: CTACGAAGGGGTCTGAGCACR: TGGGCAGGTATTGAGGTTTC56174
SP6F: CTGTCAGTGTGAAGGGCTGAR: CTCTCGGCTTCTTCCTCCTT63248
A4-1H T7F: CATTGTTTGTCCAGTGCTGTGR: ATACCTGGCTTGGCACAGAG56163
SP6F: AGGCTCATTTTCATGCCATTR: GCCCACATTTTGTTTCTATGG56247
A4-14HT7F: TGAAGACCAATGTCCTGTGGR: TGCCTTCAATTAAGCCCTCA63229

B1-7AT7F: TCAAAGTCCTCCCCAGTGTTR: CATTGACTAGGGCAGGGGTA56180
B1-8D T7F: AGCTCACCAGGAAAGGCATAR: TCTCCAGTATCCTGCGTTTG56111
SP6F: AATTCTCCCCTGGTTTCACCR: TGCAGTTGGAGGGAGCTAAT56126
B1-11CT7F: TTGGGTGTATTTTGTGGCTTCR: GCAACCAGTTCAAGGCAGAG56282
B2-10DSP6F: GTTTCTGAGGCCAAAACAGCR: GGCACCCTAGAGTTTTGCAG56154
B2-11ASP6F: GTTTCTGAGGCCAAAACAGCR: GGCACCCTAGAGTTTTGCAG56154
B3-3GT7F: AAAGCTCTATCCTTTGGAGACAGAR: TACTGGTGGCATGGTTTTGA56211
B3-7F T7F: CAGCCGTTGCAGAAATCTTAR: GCAAGGTAAGCCAAGGATTG60182
BSP6F: CTGCAGGGAAAATAGATGGTTR: GACCATGGAGAAGAAAGGTTG56259
B3-7G T7F: TCCAAGCTTAGAAGGATGCAAR: GCTCATGCTAGCAAAGCCTTA60244
SP6F: GAGCAACGTGCTAACAAAACTGR: TTTGTTATGACAATGTGGTTTCA 56150
B3-11CT7F: CCACAGCTAACGGAGTGGTTR: AAAGAAACAGGCAGGGGTTT56204
B3-12ESP6F: TGTGCCCAACTGCTACTGTCR: TACCCTCATGGGCAATTCTC60263
B3-12HT7F: CTGCAACAGAATGGCATAAGAR: GCACTCGATGTGCTTTTTCA60138
B4-1BT7F: CCCACTGGAAAAAGGAAAGAR: ATTAGCGGGTGCCCTTCTAT56199
B4-2ESP6F: ACTCCCAGGGAATTCAGGTTR: TGTGGTATTCAAGGCAGGAA56158
B4-13H T7F: GTTTCTGAGGCCAAAACAGCR: GCCACCCTAGAGTTTTGCAG 56156
SP6F: AGAGAAGGAAGGGGAGGACAR: CTGCTTCCTCCCAGTCTCAG56108

C1-1DT7F: TCTAGGCCCAATTGGTTTTGR: TCACTTAGCCCGACCCATAG63200
SP6F: TCATCTAAATGCTTGCTGTTTGR: AAATGCCTGTGCCTTTTGAG63281
C1-9BT7F: ATGGAGCTGACAAACCCTTGR: CAATCACAAGCCACATGTCC63197
C1-9DT7F: ATGGAGCTGACAAACCCTTGR: CAATCACAAGCCACATGTCC63197
C1-10GT7F: CTCTGGTCCTGGGCAAATACR: CAGCCTTTCCATCACTCCAC63214
SP6F: TGTATCCAGGAGGCATCACAR: TTGGTCTGCATTGAGGACTG63194
C2-3FSP6F: CAGCAGTGGTCCTGTTGAGAR: CCAGCCTTTGTCACTCTTCAC63265
CC2-5FT7F: TTTCGTTGCTCTCACCTTGAR: GGTGGAGTGGAGTTTGTGGA63205
C2-6CSP6F: TGCAATAGAGCAAAGGGAGAAR: AACCTGACCTTCCCCAAGAT63268
C2-6HSP6F: GGAAGATTTTTGGATACGTGTGR: TGAGTTTTCCAGTTGCATGG60163
C3-1E T7F: CTCTGAGGACACAGGCTTCCR: ACTGCCACTCCAACCACTCT60150
SP6F: CAGAACCCGTCCACTGAAATR: TCCAGGGAGAAAACTGGTTG63196
C3-4B T7F: CTCTGAGGACACAGGCTTCCR: ACTGCCACTCCAACCACTCT60150
SP6F: CAGAACCCGTCCACTGAAATR: TCCAGGGAGAAAACTGGTTG63196
C3-6FT7F: CGTGTTTGAGGAGCACACATR: GTCCACAGAAGCCAGAGAGG63211
C4-2G T7F: ATAATCACAATCTGTGGGCATAR: GCTCAACCCCAGACATTTAGAC60108
SP6F: TGCTGTTCTTTACTGGGCATTR: ATCCCAGCTGCCAAATACAC63265