Table 1: Primer sequences.

Primer sequenceProduct size (bp)Annealing temp. (°C)Reference

β1ARF: CCGCTGCTACCACGACCCCAAG44160 [11]
R: AGCCAGTTGAAGAAGAGCAAGAGGCG
β2ARF: GGTTATCGTCCTGGCCATCGTGTTTG46861v.s.
R: TGGTTCGTGAAGAAGTCACAGCAAGTCTC
β3ARF: TCTAGTTCCCAGCGGAGTTTTCATCG33764v.s.
R: CGCGCACCTTCATAGCCATCAAACC
α1AF: GGACAAGTCAGACTCAGAGCAAGTGACG40461v.s.
R: TATAGCCCAGGGCATGCTTGGAAGAC
α1BF: TTTCATGAGGACACCCTCAGCAGTACC45261v.s.
R: CTGCCGCTGTCATCCAGAGAGTCC
α1DF: CGCCAAAGGAAATCCAGGGACAC61761v.s.
R: CAGAGCGGAACTTATGGGACAGG
M1F: GTAAGGTGCCTGCCATCCAATC41758 [12]
R: CGCAGCTCACTTTCTGCATTGT
M2F: TGTCAGCAATGCCTCCGTTATG48058v.s.
R: GCCTTGCCATTCTGGATCTTG
M3F: GGTGTGATGATTGGTCTGGCTTG49762v.s.
R: GAAGCAGAGTTTTCCAGGGAG
M4F: TCAAGAGCCCTCTGATGAAGCC47762v.s.
R: AGATTGTCCGAGTCACTTTGCG
M5F: GCTGACCTCCAAGGTTCCGATTC48554v.s.
R: CCGTCAGCTTTTACCACCAAT
3β-HSDF: ACTGCAGGAGGTCAGAGCT56555 [13]
R: GCCAGTAACACACAGAATACC
PCNAF: TGGAATCCCAGAACAGG28755 [14]
R: ACAGTGGAGTGGCTTTT
GAPDHF: AAACCCATCACCATCTTCCAG36154 [15]
R: AGGGGCCATCCACAGTCTTCT

F: forward; R: reverse.