Table 1: Primer pairs for qRT-PCR validation of differentially expressed genes involved in apoptosis.

Gene symbolGenBank AccessionPrimer (5′ 3′)

GSNNM_198252FCGAAGAGGTTCCTGGTGAGC
RGCTGGGTCCGTCTCGATGTA
TP53INP1NM_033285FCTTCTCATTGAACATCCCAGCA
RTGGGTTGTTCCAGAAAAGTTGTA
TNFSF9NM_003811FGAGCTTTCGCCCGACGAT
RGCTCCTTCGTGTCCTCTTTGTAG
DDIT4NM_019058FCCGAACTCCCACCCCAGA
RGCAACGACACCCCATCCA
POLR2GNM_002696FAAGATTGTGGGGACCCGTGT
RGGATGAGTTGCCTTCCTTGC
LGALS1NM_033101FCAACCCTCGCTTCAACGC
RGGCGGTTGGGGAACTTGA
BBC3NM_014417FCGGACGACCTCAACGCAC
RGCACCTAATTGGGCTCCATCT
FOXO3NM_001455FGGGGAACTTCACTGGTGCTAA
RAACGGTATCACTGTCCACTTGC
PUF60NM_014281FCTGTTTCCCGAGTCAGAGCG
RCTCCTCTGTCACCTCCCCTTC
RRAGANM_006570FTGGTCATGTCAGATCCGTCG
RAAGGCAATTCAGCATTTTCAGA