Table 1: Oligonucleotide sequences and primer probes used for RQ-PCR analysis.

Transcript Sequence (5′–3′ direction)Probes numberGene accession no.Product size (bp)

GAPDHF: TCCCTCAAGATTGTCAGCAA28 NM00100314268 bp
R: TGGATGACTTTGGCTAGAGGA
β-actinF: GATCACCATTGGCAACGAG 12NM001003349111 bp
R: CCCAGGAAAGAAGGTTGGA
INH BF: ATCATCCAGGGGTCCTGTG26NM001164842
101 bp
R: GACTGGGTGGGTCAACAAAG
INH AF: AGCGTGTGGACCTGAAGC28NM214189.1105 bp
R: ACTGCACGTCCAGGTTGAG