Table 1: Leptospiral selected proteins for characterization of the binding to PLG. Gene locus, protein name, NCBI reference sequence, features, gene conservation, sequence of the primers employed for DNA amplification, and molecular mass of expressed recombinant proteins.

Gene locu1Recombinant protein given nameNCBI reference sequence number2Description/FunctionConservation
(identity)3
Sequence of primers for PCR amplificationRecombinant protein molecular mass (kDa)

LIC11352LipL32a, hYP_001316Major outer membrane protein (MOMP), LipL32 lipoproteinLai (100%);
LBH (98%)
F: 5CACCGGTGCTTTCGGTGGTCTG 3
R: 5ATTACTTAGTCGCGTCAGAAGC 3
30.2
LIC10314Lsa63b, hYP_000304Conserved hypothetical protein with Borrelia_P83 domainLai (98%);
LBH (87%);
LBP(39%)
F: 5GGATCCTTATTTTCTCAGGAAAG 3 (BamH I)
R: 5GGTACCCTAAGGTTTAATTTTTTT 3 (Kpn I)
63.0
LIC10509rLIC10509c, hYP_000493Putative lipoproteinLai (98%)F: 5CCGGGATCCAAAAAGAGCAAAGAAG 3 (BamH I)
R: 5GGTACCCTACTCGAGACAGCCAGGACCTTC 3 (Kpn I)
22.0
LIC12892Lp29d, hYP_002808Putative lipoproteinF: 5CTCGAGGCAGTACATTACAATCTTGCT 3 (Xho I)
R: 5CCATGGCTCTTAGGAGCCTGGAAA 3 (Nco I)
29.6
LIC10793Lp49d, hYP_000772Putative lipoprotein, Surface antigenLai (99%);
LBH (86%)
F: 5CTCGAGAGCGGAGACTTTTCTTTACTT 3 (Xho I)
R: 5CCATGGTTAAAAACCATCTCTACGATAAAC 3 (Nco I)
49.1
LIC12895Lsa27e, hYP_002811Putative lipoproteinLai (79%)F: 5GGATCCCTGAAATATACGAA 3 (EcoRI)
R: 5GAATTCTTACTGTTCTCCTTC 3 (BamHI)
27.0
LIC13131MPL21a, f, hYP_003039Hypothetical protein with Ycel domainLai (98%);
LBP (45%)
F: 5CACCACGTCTCAAAGTTACGCTTCAG 3
R: 5 TTCTCACCATCCAGCTCGG 3
21.9
LIC10765MPL17a, f, hYP_000745Conserved hypothetical proteinLai (100%);
LBH (80%);
LBP (41%)
F: 5 CACCGAAAGTCCCGTAAGGTTCAAA 3
R: 5TGCAGGAGTTCCCACATTTTA 3
15.4
LIC10091LipL40a, hYP_000088Putative lipoproteinLai (100%);
LBH (84%)
F: 5CCATGGGACTCGAGACGCCTCCTCCTAAAGATCC 3
R: 5CTCCATGGTCATTTCAAAACTTCTACGGGGC 3
39.0
LIC10054MPL36a, hYP_000054Putative lipoprotein with Rare lipoprotein A (RplA) like domainLai (100%);
LBH (88%);
LBP (50%)
F: 5CACCACGTCTTGTGCGTCGGTAGAG 3
R: 5CCAAGTATTCTATTTATACGTCCGAG 3
35.1
LIC10494rLIC10494g, hYP_000478Putative lipoproteinLai (99%)F: 5CACCACTGCTAGGGCTGCAGAAA 3
R: 5ACTTTGAGAGCTTCGTCTCGT 3
25.8
LIC12730rLIC12730g, hYP_002650Hypothetical protein with TPR domain and 4 NHL repetitionLai (100%);
LBH (90%);
LBP(37%)
F: 5CACCAGTTCTGACGGACTTCCCAA 3
R: 5TCTTGCGAATGAGTTGATCC 3
77.4
LIC12922rLIC12922hYP_002837Conserved hypothetical proteinLai (100%);
LBH (89%);
LBP (48%)
F: 5CACCGAATCACTCAACAGAGTCATTGC 3
R: 5ATCAATCTAAATGAAACGTCTCTTC 3
40.0
LIC12238rLIC12238h, iYP_002173Hypothetical proteinLai (99%);
LBH (77%);
LBP (39%)
F: 5CTCGAGTGTTTTAAACCTACCGGAG 3 (Xho I)
R: 5AAGCTTCTACTTCATCGCTTTTTCTATATC 3′ (Hind III)
17.6
LIC10258Lsa66iYP_000249Hypothetical protein with ompA domainLai (99%);
LBH (79%)
F: 5GGATCCGAAGCCTTCTCACCCAATTG 3 (BamH I)
R: 5CCATGGTTAAAGTGAAAGATAAAAATCGATTC 3 (Nco I)
65.7
LIC12880Lp30iYP_002796Putative lipoproteinLai (99%);
LBH (76%)
F: 5CTCGAGGAAGTTGTCCGAGTCTAT 3 (Xho I)
R: 5CCATGGTTATTGATTGTTTAATTCAG 3 (Nco I)
30.7
LIC11469Lsa20jYP_001430Hypothetical proteinLai (100%);
LBH (82%);
LBP (29%)
F: 5CTCGAGCCAATTTCTTTCGATCCAAATC 3 (Xho I)
R: 5AAGCTTTCAATCCTCTACTGCAGCCC 3 (Hind III)
20.0
LIC11030rLIC11030g, jYP_001000Putative lipoprotein with unknown domain (DUF1565)Lai (100%)F: 5CTCGAGTGTACAAACGAAAAAGAAGGT 3 (Xho I)
R: 5AAGCTTTTAGTTGCAAGGATTTGGA 3 (Hind III)
37.0
LIC11834rLIC11834k (Lsa33)YP_001783Putative lipoproteinLai (99%);
LBH (87%);
LBP (31%)
F: 5CTCGAGGATCTACAAGGTGGGGTTTTTAC3 (Xho I )
R:5CCATGGTTACTGAGGTTTTACTTGGTCC3 (Nco I)
33.1
LIC12253rLIC12253k (Lsa25)YP_002188Conserved hypothetical proteinLai (100%);
LBH (77%);
LBP (39%)
F: 5CTCGAGGAGGAGAAACCGGACGATAC 3 (Xho I)
R: 5CCATGGTTAGGGAAGACTTCTAACACATC 3 (Nco I)
24.0

1http://aeg.lbi.ic.unicamp.br/world/lic/.
2http://www.ncbi.nlm.nih.gov/protein/.
3Protein BLAST—http://www.ncbi.nlm.nih.gov/blast/Blast.cgi.
aPreviously published by Gamberini et al. [78];
bPreviously published by Vieira et al. [37];
cPreviously published by Gómez et al. [79];
dPreviously published by Neves et al. [80];
ePreviously published by Longhi et al. [19];
fPreviously published by Oliveira et al. [81];
gPreviously published by Barbosa et al. [18];
hPreviously published by Vieira et al. [37];
iPreviously published by Oliveira et al. [38];
jPreviously published by Mendes et al. [39];
kPreviously published by Domingos et al. [40];
Lai: L. interrogans serovar Lai [8]; LBH: L. borgpetersenii serovar Hardjo-bovis [11]; LBP: L. biflexa serovar Patoc [12].