Table 1: The primers and probes for detection of Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp. and Burkholderia pseudomallei by multiplex PCR suspension arrays.

Target organismNameSequence (5′-3′)Gene locationProduct size

Bacillus anthracisBA-1-F TGGACGCATACGAGACATAATcapB430 bp
BA-1-R TGCTTTAGCGGTAGCAGAGG
BA-1-P GAAGAACGCAGGCTTAGATTGGT
BA-2-F TTTCATAATCATGGATTTCCCGchromosome212 bp
BA-2-R TTACCCAACATCATCTTCGCA
BA-2-P CTCGCTTTCATCGCATTTCTCCC
Brucella spp.Bru-F TGGCTCGGTTGCCAATATCAABCSP31223 bp
Bru-R GCGCTTGCCTTTCAGGTCTG
Bru-P TTACGCAGTCAGACGTTGCCTAT
Francisella tularensisFT-F GGGCAAATCTAGCAGGTCAAGfopA250 bp
FT-R GCTGTAGTCGCACCATTATCCT
Ft-P TGCTGGTTTAACATGGTTCTTTGG
Yersinia pestisYP-F ACTCAATGTTGTGACGAGGATGchromosome220 bp
YP-R TTACTTCTAATGCCATCAGGTAGC
Yp-P AACAGTAAGCATCCAGTCGTTCATA
Burkholderia pseudomalleiBP-F CGATCTCGTCAAGGTGTCGGchromosome150 bp
BP-R CCCCAGTTCATCTGATACTTGC
Bp-P AGGTCAATTTCCCGAACAAGACT