Table 1: Sequences of the PCR primers used to genotype SNPs in the DCM patients and control subjects.

MarkersForward primer (5′-3′)Reverse primer (5′-3′)Amplicon size (bp)Temp. (°C)GC (%)

rs7521796TGCCAACAGAGAGGTGCTTCCTTGAGGCTCAGCCTAATTG9346.556.3
rs2275862AATATGAGGTGGGCCGCCATTATTACCGGACCCAGTGAAC9948.452.9
rs3729547GAAGGACCTGAATGAGTTGC AGAAACGAGCTCCTCCTCCT9950.260
rs10800775AATCCCCTCCCAGGTCTTTGTCATGTCATCAGCTTCTGCC9850.747.4
rs1892028AGAGGGGACCATTGTCCAGTCTAGGAGCTTCATGTGTGG1004862.5
rs3729843TCAAGGTCCTTGTTCTGAGCTCTTGGCTAGGGCTTATCTG9947.144.4
rs3729842TCAACGTTTGTTGATTGGGCAGAACAGGCTTTCCCATGTG9946.731.8
rs12563114TGGAAGGGCAGAGTAGGAGAAATTCTCAGAGGAACCGTGC10045.244.4
rs12564445AACTCGGAGACTGTTTCTACCTCTCTGACTTCAGTTAACC9547.747.1
rs4915232CAATCTCGCTATTCTCTGCCAGAAGAGTTTGAGGACTGGG9548.662.5