Table 1: Reverse transcriptase-polymerase chain reaction primers.

GeneSequence 5′-3′Size

MMP-9Forward: GTTGGGGAGGGCTGTCCGTGA911 bp
Reverse: CGTGGCGCTATCCAGCTCACC
ICAM-1Forward: CGCCCGATTGCTTTAGCTTG320 bp
Reverse: CGACTCACCTGGGAACAGAG
VEGFForward: TCAAGGTTGGCGGAAGTGAGG443 bp
Reverse: CCCTTGCATCAGTAGGCTTCA
FGF2Forward: GCCTCATTTCCATTTCGTGG224 bp
Reverse: CGGGGGTACTGGTTTACAG
-actin
 
Forward: CATGGATGATGATATCGCCGC319 bp
 
Reverse: ACATGATCTGGGTCATCTTCT