Table 1: Primer sequences used for long-range PCR to characterise the breakpoints of the MSH2 exon 6 deletion.

PrimerSequenceNucleotide position
(NG_007110.1)
Amplicon size
(bp)

5FPGGATATTGCAGCAGTCAGAGCCC11258–11280
7RPAGAGTGAGTCACCACCACCAACT26890–2691315657 bp
6RPlAGCTTTTCTGGAGGCCATAGGCA24694–2471713459 bp
6RPiAGTCTGGTCCAAGGATCACCAGCA23620–2364412386 bp
6RPhTCGTCGGTGGAAGAGGTGGCT22565–2258611328 bp
6RPgAGCCCATGAAGAGAGCTGACACC21580–2160310345 bp