Table 1: List of sequence and GenBank accession number.

GeneGenBank accession numberPrimers sequence (5′ to 3′)Product size

Rac1NM_018890.3Forward: TGGGATACAGCTGGACAAGA125 bp
Reverse: CCGATTGCCGATGTGTT
Probe: TATCCGCAAACAGTTGGAGAAACGT

RasNM_176795.3Forward: CACCAAGTCTTTTGAGGACATCCA70 bp
Reverse: CACGTCATCCGAGTCCTTCAC
Probe: ACAGGGAGCAGATCAA

V4UPM_HNX85971.1Forward: CAGCACACCTAGCGATCTTGTAG79 bp
Reverse: TGGAACCGAGTGCAGATGTAATC
Probe: CCGACTGCGATCTCT