Table 1: Primers sets used to amplify cDNA from exons 11–20 of PDGFβR in EqS cells.

Primers setsAnnealing positionAnnealing Fragments size

F1: ATCCTCATCATGCTCTGGCAGF1: 211952°C628 bp
R1: TCTCCTTTCATGTCCAGCATGR1: 2747
F1: ATCCTCATCATGCTCTGGCAGF1: 211952°C1226 bp
R3: TCGAGAAGCAGCACCAGCTGR3: 3344
F3: TGGCTACATGGACATGAGCAAGF3: 268252°C663 bp
R3: TCGAGAAGCAGCACCAGCTGR3: 3344
F3: TGGCTACATGGACATGAGCAAGF3: 268252°C593 bp
R2: ATCTCGTAGATCTCGTCGGAGR2: 3275

: temperature; F: forward; R: reverse; bp: base pairs.