Table 1: Primers used in this study.

VirusPrimer namePrimer sequence ( )PCR product

Influenza A virusINF-A-F1AAGGGCTTTCACCGAAGAGG 190 bp
INF-A-R1CCCATTCTCATTACTGCTTC
Influenza B virusINF-B-F1ATGGCCATCGGATCCTCAAC 249 bp
INF-B-R1TGTCAGCTATTATGGAGCTG