Table 1: Target regions, primer sequences, and size of amplified fragments.

Region TargetPrimer sequences Product size (bp)

PIN3Intron 35 GGGACTGACTTTCTGCTCTTGT 3147 or 163
5 GGGACTGTAGATGGGTGAAAAG 3
Region 1Exon 45 TTGCCGTCCCAAGCAATGGATGAT 3199
5 TCTGGGAAGGGACAGAAGATGAC 3
Region 2Exon 5 and 65 GCCGTCTTCCAGTTGCTTTA 3488
5 TAACCCCTCCTCCCAGAGAC 3
Region 3Exon 75 TTGGGCCTGTGTTATCTCCT 3253
5 TGATGAGAGGTGGATGGGTAG 3
Region 4Exon 85 CAAGGGTGGTTGGGAGTAGA 3331
5 TGCTAGGAAAGAGGCAAGGA 3