About this Journal Submit a Manuscript Table of Contents
BioMed Research International
Volume 2013 (2013), Article ID 307145, 7 pages
http://dx.doi.org/10.1155/2013/307145
Research Article

miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

Al-Farabi Kazakh National University, 71 Al-Farabi Avenue, Building No.6, Almaty 050038, Kazakhstan

Received 26 February 2013; Revised 20 May 2013; Accepted 23 June 2013

Academic Editor: Vassily Lyubetsky

Copyright © 2013 Assyl Bari et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Supplementary Material

Supplemental table S1: Nucleotide variability of miR171 binding sites in mRNA of HAM orthologous genes. The nucleotide sequences of miR171 binding sites are highly conserved in the mRNAs of 37 HAM orthologous genes and encode GAUAUUGGCGCGGCUCAAUCA sequence.

Supplemental Table S2: Amino acid variability of HAM orthologous proteins in regions with the ILARLN oligopeptide. The amino acid sequences of miR171-binding sites in HAM orthologous proteins are conserved and encode the same ILARLN motif.

  1. Supplementary Tables