Table 1: The primer sequences for amplification of the S. aureus enterotoxin genes.

Target genePrimer sequence 5′ 3′Size of PCR product (bp)Reference

sea (F)
(R)
GAAAAAAGTCTGAATTGCAGGGAACA
CAAATAAATCGTAATTAACCGAAGGTTC
560[26]
seb (F)
(R)
ATTCTATTAAGGACACTAAGTTAGGGA
ATCCCGTTTCATAAGGCGAGT
404[26]
sec (F)
(R)
CTTGTATGTATGGAGGAATAACAAAACATG
CATATCATACCAAAAAGTATTGCCGT
275[26]
sed (F)
(R)
GAATTAAGTAGTACCGCGCTAAATAATATG
GCTGTATTTTTCCTCCGAGAGT
492[26]
see (F)
(R)
CAAAGAAATGCTTTAAGCAATCTTAGGC
CACCTTACCGCCAAAGCTG
482[26]
seg (F)
(R)
ACCTGAAAAGCTTCAAGGA
CGCCAACGTAATTCCAC
204[26]
seh (F)
(R)
CAATCACATCATATGCGAAAGCAG
CATCTACCCAAACATTAGCACC
376[26]
sei (F)
(R)
CTYGAATTTTCAACMGGTAC
AGGCAGTCCATCTCCTG-3
461[26]
sej (F)
(R)
TCAGAACTGTTGTTCCGCTAG
GAATTTTACCAYCAAAGGTAC
138[26]
sek (F)
(R1)
(R2)
ATGCCAGCGCTCAAGGC
AGATTCATTTGAAAATTGTAGTTGATTAGCT
TGCCAGCGCTCAAGGTG
134[26]
sel (F)
(R)
GCGATGTAGGTCCAGGAAAC
CATATATAGTACGAGAGTTAGAACCATA
234[26]
sem (F)
(R)
CTATTAATCTTTGGGTTAATGGAGAAC
TTCAGTTTCGACAGTTTTGTTGTCAT
326[26]
sen (F)
(R)
CGTGGCAATTAGACGAGTC
GATTGATYTTGATGATTATKAG
474[26]
seo (F)
(R)
AGTTTGTGTAAGAAGTCAAGTGTAGA
ATCTTTAAATTCAGCAGATATTCCATCTAAC
180[26]
sep (F)
(R)
GAATTGCAGGGAACTGCT
GGCGGTGTCTTTTGAAC
182[26]
seq (F)
(R)
ACCTGAAAAGCTTCAAGGA
CGCCAACGTAATTCCAC
204[26]
ser (F)
(R)
AGCGGTAATAGCAGAAAATG
TCTTGTACCGTAACCGTTTT
363[26]
seu (F)
(R)
AATGGCTCTAAAATTGATGG
ATTTGATTTCCATCATGCTC
215[26]
tst (F)
(R)
TTCACTATTTGTAAAAGTGTCAGACCCACT
TACTAATGAATTTTTTTATCGTAAGCCCTT
180[26]
eta (F)
(R)
ACTGTAGGAGCTAGTGCATTTGT
TGGATACTTTTGTCTATCTTTTTCATCAAC
190[26]
etb (F)
(R)
CAGATAAAGAGCTTTATACACACATTAC
AGTGAACTTATCTTTCTATTGAAAAACACTC
612[25]
etd (F)
(R)
CAAACTATCATGTATCAAGGATGG
CCAGAATTTCCCGACTCAG
358[26]