Research Article
Further Evidence of Mutational Heterogeneity of the XPC Gene in Tunisian Families: A Spectrum of Private and Ethnic Specific Mutations
Table 1
Microsatellite markers surrounding the XPC locus.
| Microsatellites markers | Physical distance (pb) | Genetic location (cM) | Heterozygosity | Number of alleles | Primers sequence | Allele size range | Fluorescence |
| D3S3602 | 13.926.066–13.926.191 | 31.40 | 57.69% | 7 | F: AAAATCCTAACCCAAAATGT R: ATCAGAAAATAACAGAGGGC | 114–132 | FAM |
| D3S1585 | 13.941.728–13.941.855 | 33.00 | 57.14% | 8 | F: TGCACGAGCCAGAAGT R: TTGGACTGCTGAGGGG | 126–144 | NED |
| D3S3613 | 15.361.998–15.362.181 | 35.70 | 78.57% | 8 | F: CATCTATGTGGCAATCGG R: CAGCATTTGTTGTAGGGACT | 172–208 | FAM |
|
|