Table 1: Microsatellite markers surrounding the XPC locus.

Microsatellites markers Physical distance (pb)Genetic location (cM)HeterozygosityNumber of allelesPrimers sequenceAllele size rangeFluorescence

D3S360213.926.066–13.926.19131.40 57.69%7F: AAAATCCTAACCCAAAATGT
R: ATCAGAAAATAACAGAGGGC
114–132FAM

D3S158513.941.728–13.941.85533.00 57.14%8F: TGCACGAGCCAGAAGT
R: TTGGACTGCTGAGGGG
126–144NED

D3S361315.361.998–15.362.18135.70 78.57%8F: CATCTATGTGGCAATCGG
R: CAGCATTTGTTGTAGGGACT
172–208FAM