Table 2: Sequence primers used for PCR amplification of XPC and GAPDH genes.

PCRPrimer SensePrimer Anti-sense  °C

XPCExon 4ATGCCTCACTTCCTCCTTCCCACTTTGATACTCAGTCCTGGTCCC55
Exon 5GATTCACTGTCATCCGAGGAGAAGCAAAGGCTCAGAGAGAGTAAGAAACTTG55
Exon 6TGAAAGACAAGACCAAAACAAAAACAGGACCTGAACCCAGCCTCTGAG55
Exon 7CTCCCTCTTTTTATTTTCTTGGCTGGGTGCCTGTAGGCATTTGATAAAGC55
Exon 8 TTGAACAAGCACCATAACAAACAACTGCCCAAGTCTTCCCTAACACAG55
Exon 9CCAGGGTGTCTTATAAAGAGGCAAGGCCTTACCTCCAAG55
Exon 10CCTTGGCTCCACCATCTGTTGCCCTGTAACTGTTTTTCCCCTGC60
Exon 11AGATTAGGGTTTGTAAGTGGACACATCGGACTGGGAGGCTCATCATCAC55
Exon 12CTGGTAGGTGTGTTCTGAGGGTTCCGGTGTAGATTGGGCAGGTTC60
Exon 13GGCAGCATCAGAAGGGCTCAGAAATCCAGTGTAACATCCTGAAAATTG60
Exon 14AGGCTGGATAGGGGCTTTCACCCTGCTGTATTCAGTGCTCGCTC60
Exon 15CCACTAAAGATTTTGGAGTCAGTAACGACAGGGCTTGGGGCAGAAGAG55
Exon 16CCCTTGTCCTCCCAGAGTTACACATGCTGCCTCAGTTTGCCTTC60
cDNATTGAAGAACTTAGTGAGCCTGTGGCTGGGTTGCCTTCTCCT60

GAPDHcDNAGAGTCAACGGATTTGGTCGTTTGATT TTGGAGGGATCTCG60