Table 5: Details of the SSR primers for genetic diversity analysis.

Prime PairsSequence IDSSR motifForward primer (5′-3′)Reverse primer (5′-3′)Expected product size (bp)

Bp-01AC 1.3(CA)8TCACACACACACACACAAAAACATGGATTGCGCTGAGCTG119
Bp-08AC 6.3(TG)8ATGATGCCAGTGGAGTGTTCACACACACACACTTTTCTCATTG152
EP-02DT339694(GAA)7CGTGCCGCATAAATCATTATCTCCTCGCTCCTCTTG116
EP-05DT339172(CCAT)8 (AT)7CAGCCAATAACAACCTCAAGTCCATACACACAGTACGTCG263
EP-06DT339094(CTTTTT)5CGACTCGAGGATTACATTACGGAGCACAAAGAACCACACAG270
EP-09DT338799(TC)19CCGAGGAAGAAGAAGAGGTGGTCCACAGTTGTTTCAGTT160
EP-10DT338783(GAT)7GACCTTTATCCATCGCATCCCATCAAACGTGAAATCTTG266
EP-11DT338752(CAGGAG)5AGCGAGATAGCAGAGATAGGTAGAGCGATGTTCGGATG180
EP-12DT338506(AG)6 (AG)6TTAACACATGCACGGAGTACCTAAGAGACAACCCAGGAAG236
EP-13DT338494(CCAT)8 (AT)8GCCAATAACAACCTCAAGCTCCATACACACAGTACGTCG263
EP-15DT338171(GCAGTC)7ACCTACAAGTGGTACGTCGGGAGCAAGGAGTTATTCAG242
EP-16DT338171(TC)6 (AG)18TAGTGAGTCAGGAGGAGAATGCAAATAAACGGAGCGGAT212
EP-20DT337383(TCT)8TAATCGGGTGGAGTAAGGGCTCACATAGGCCAATATG155
EP-23DT337096(TC)20ATGGTGGTTCACTTATCAGCAGACATTCAAAGCGGAGAG126
EP-24DT337054(CT)10GCTGCTCTTGCTGCCATAAGCCATAGGACCACCAC166
EP-26DT336292(AT)8GAAGCGCAGGTTCGTAATACAGAAGTAGAGGAAAGCAGC227
EP-27DT336032(TCT)6ATACTCTGCTGCTGTGAACGTTGCACTCCTCTTTGCTAAC155
EP-29CO731867(AGC)9GCGAGCCTGTTAGACTTTGTACGATCTCAGCTGGACCTT213