Table 2: Primers for PCR-RFLP of the TLR4, restriction enzymes used, and base pair products for genotypes.

SNP ID Forward primer Reverse primer Restriction enzyme used Product size and genotypes

rs4986790 CTGCTCTAGAGGGCCTGTG TTCAATAGTCACACTCACCAG BccI 140 = AA
140, 77, 63 = AG
77, 63 = GG
rs4986791 CTACCAAGCCTTGAGTTTCTG AAGCTCAGATCTAAATACT BslI 110 = TT
110, 89, 22 = TC
89, 22 = CC
rs11536858 ATAACCTCAGTGGGCTCTGG ATGTTCTGGCATCTGGGAAG KpnI 241 = AA
241, 190, 51 = AG
190, 51 = GG
rs1927911 TCACTTTGCTCAAGGGTCAA AAACCTGCATGCTCTGCAC StyI 203 = TT
203, 178, 25 = TC
178, 25 = CC
rs1927914 ACAAAATGGTCCCTCACAGC TGGAAAGTAGCAAGTGCAATG SphI 150 = TT
157, 90, 67 = TC
90, 67 = CC