Table 1: Primer information.

PrimerSequence - GeneSize (bp)Concentrationsa

FluA FAGGTGACACTATAGAATATTCTAACCGAGGTCGAAACGM 27075 nM/L
FluA RGTACGACTCACTATAGGGAACAAAGCGTCTACGCTGCAG
FLuB FAGGTGACACTATAGAATAAAAAGRAGATTCATCACAGAGCM 16650 nM/L
FLuB RGTACGACTCACTATAGGGATTCTGCTATTTCAAATGCTTCA
sH1N1 FAGGTGACACTATAGAATAGGTATGCTTTTGCAMTGARTAGAGGHA25075 nM/L
sH1N1 RGTACGACTCACTATAGGGAAAGGGATATTCCTTARTCCTGTARCCAT
PIV1 FAGGTGACACTATAGAATATCTCATTATTACCYGGACCAAHA28487.5 nM/L
PIV1 RGTACGACTCACTATAGGGATCCTGTTGTCGTTGATGTCATA
PIV2 FAGGTGACACTATAGAATATCTACACTGCATCAGCCAGCHA 19450 nM/L
PIV2 RGTACGACTCACTATAGGGACCCCTAAAAGAGATGAGCCC
PIV3 FAGGTGACACTATAGAATATTGTCAATTATGATGGYTCAATCTHA 23075 nM/L
PIV3 RGTACGACTCACTATAGGGAGACACCCAGTTGTGTTGCAG
HRV FAGGTGACACTATAGAATACCCCTGAATGYGGCTAACCT UTR14450 nM/L
HRV RGTACGACTCACTATAGGGACGGACACCCAAAGTAGTYGGT
HMPV F1AGGTGACACTATAGAATACATGCCCACTATAAAAGGTCAGL 208100 nM/L
HMPV R1GTACGACTCACTATAGGGACACCCCAGTCTTTCTTGAAA
HMPV F2AGGTGACACTATAGAATAGAGCTAAYAGAGTGCTAAGTGATGN 20850 nM/L
HMPV R2GTACGACTCACTATAGGGAACTTTCTGCTTTGCTTCCTGT
Adv FAGGTGACACTATAGAATAGCCSCARTGGKCWTACATGCACATCHexon338100 nM/L
Adv RGTACGACTCACTATAGGGACAGCACSCCICGRATGTCAAA
NL63 FAGGTGACACTATAGAATATCCCAAATGTGATAGAGCTTTGCPolym-erase17650 nM/L
NL63 RGTACGACTCACTATAGGGACTGTTAAAACTTGTGCCAACTC
OC43 FAGGTGACACTATAGAATAATTGCACCAGGAGTCCCAN 20050 nM/L
OC43 RGTACGACTCACTATAGGGATATCGGTGCCGTACTGGTCT
229E FAGGTGACACTATAGAATACTCGGAATCCTTCAAGTGACAGAN 18350 nM/L
229E RGTACGACTCACTATAGGGAACGAGAAGGCTTAGGAGTAC
HKU1 FAGGTGACACTATAGAATATATAGTRAAACCTGATATGGCTN 22050 nM/L
HKU1 RGTACGACTCACTATAGGGATACCAAAACACTGTTGAACAT
RSVA FAGGTGACACTATAGAATACATCCCCTCTATGCACAACCF15850 nM/L
RSVA RGTACGACTCACTATAGGGACATGTTTCAGCTTGTGGGAA
RSVB FAGGTGACACTATAGAATAAAACGAAGATTTCTGGGCTTCF 279100 nM/L
RSVB RGTACGACTCACTATAGGGATGCGACAGCTCTGTTGATTT
HBoV FAGGTGACACTATAGAATAAAGAAAAGGGAGTCCAGAANP1290100 nM/L
HBoV RGTACGACTCACTATAGGGACTCTGTGTTGACTGAATACAG
Rnasep FAGGTGACACTATAGAATAGAGGCCTGGCTTTTGAACTTRNase-P12525 nM/L
Rnasep RGTACGACTCACTATAGGGAATCAAATTGAGGGCACTGGA
Tag FAGGTGACACTATAGAATA50 nM/L
Tag RGTACGACTCACTATAGGGA

Varied primer concentrations in 25 μL PCR mixture.