Table 1: UGT1A1 gene primers used in PCR and sequencing.

RegionPrimerPrimer sequence (5′→3′)

ProGCDH_pro_1FGCTACTTGGAGGCTGAGGTG
GCDH_pro_1RTGAGGCTTTTCATTGGTTCC
ProGCDH_pro_2FAACTGACCAACCAGGAGTGG
GCDH_pro_2RCTCTCAGGGCCATGCTCTCT
Exon 1GCDH9_ex1FGATTTCCACAGGCAAGGCTA
GCDH_ex1RCTCCTTCCCTCCACACTCC
Exon 2GCDH_ex2FGGAACCAATGAAAAGCCTCA
GCDH_ex2RGCGACCAGAGGTCCTTACAC
Exon 3GCDH_ex3FTCGCTCTGAGAGAGCATGG
GCDH_ex3RCTGCCTTAGTGCCTCTGACC
Exon 4GCDH_ex4FCAGGGTCAGAGGCACTAAGG
GCDH_ex4RGAAAAACTGCAAAGGGACCA
Exon 5GCDH_ex5FAGATCCTCATCAGGGACACCT
GCDH_ex5RCCAGCTACTAGAGGGGTGGAG
Exon 6GCDH_ex6FGCCACAATTTCCCAGTCTGT
GCDH_ex6RCAGAATAGGCTCAGGGGACA
Exon 7GCDH_ex7FCATATTGGTCAGGCTGGATTTT
GCDH_ex7RCACTACAAACAGATCGGCCATA
Exon 8GCDH_ex8FTGGGACCAAGACCTGGTAAG
GCDH_ex8RCCGGCTGAGTAAGAATCACC
Exon 9GCDH_ex9FTTCCCTGCTTCAGAGTTGGT
GCDH_ex9RAGGACGTCACTGGTCATTCC
Exon 10GCDH_ex10FCAGTGACGTCCTTCTGAGCA
GCDH_ex10RAGGACAAGAGGGACAGCAGA
Exon 11GCDH_ex11FGGACCTGAACCTTCTGCTGT
GCDH_ex11RCTCCAGATGAGGGACAGAGG
Exon 12GCDH_ex12_1FTGGCCTCACAGTCTTCTCCT
GCDH_ex12_1RCTCCCTCACTCTGCTCCAAC
Exon 12GCDH_ex12_2FGGATGGAGTGGGAAGTGAGA
GCDH_ex12_2RCCAGACCACTCTAGGGGAAA