Table 1: The primer sequences of VDR gene polymorphisms.

SNPPrimer name Sequences (5′-3′)

rs2228570FokI forwardF: GTGGGTGGCACCAAGGAT
FokI reverseR: TCACAGGTCATAGCATTGAAGTG

rs731236TaqI forwardF: GTGGGATTGAGCAGTGAG
TaqI reverseR: TTCTGGATCATCTTGGCATAG

VDR: vitamin D receptor, SNP: single nucleotide polymorphism.