Table 1: Sequence of Primers.

GenePrimers (F: Forward; R: Reverse)Amplicon size (bp)

Integrin α5F:TGGACTGGCAGAAGCAGAAGG195 bp
R:CCAAGGAGAAGTTGAGTGCGATGT
Integrin β1F:GTGCTGAAGACTACCCCATC158 bp
R:CTCCACAAAAGAGCCAAATC
Integrin αVF:TCAAGATGGAGCAAAGAC134 bp
R:CAGGACCACCAAGAAGTA
Cbfα-1F:GCCACCTCTGACTTCTGC 107 bp
R:GAAATGCTTGGGAACTGC
ALP F:AACCTGGTGGAGGAGGGC 129 bp
R:CATGTCTGAGGGCTCAAAGAG
GAPDHF:CACTTCGGCATTGTGGAG131 bp
R:GAGGCAGGGATGATGTTCT