Table 1: Genes and primer pairs used in this study.

GenesPrimer pairs sequences (5′–3′)Annealing temperatures (°C)Amplicons (bp)Accession numbers

MeqForward
Reverse
ACGCAGGGAGCAGACGTACTAT
CCATAGGGCAAACTGGCTCAT
63°C155YP_001033993
MDA-5Forward
Reverse
GTTGCTGTAGGAGATGCAAGTG
ATCTGGCTCAGGTGAAGCTCT
60°C114NM_001193638
IRF-3Forward
Reverse
TACACTGAGGACTTGCTGGAGGT
AAGATGGTGGTCTCCTGATCC
62°C170NM_205372
IFN-αForward
Reverse
CAGGATGCCACCTTCTCTCAC
AGGATGGTGTCGTTGAAGGAG
60°C113NM_205427
IFN-βForward
Reverse
CCTCAACCAGATCCAGCATTAC
CCCAGGTACAAGCACTGTAGTT
59°C167NM_001024836
GAPDHForward
Reverse
AGGACCAGGTTGTCTCCTGT
CCATCAAGTCCACAACACGG
62°C153NM_204305