Table 2: Oligonucleotides used in this work.

PrimersSequence (5′-3′)Purpose

Hxt7 upstream-HXCATAGATCTCTCACAAATTAGAGCTTCAATTTAATCloning the fragment of HXT7p-araA-PGKt1
Pgk6 downstream-SCATGTCGACAGCAATTTAACTGTGATAAACTACCGCloning the fragment of HXT7p-araA-PGKt1
Hxt7 upstream-EEBCATCGGCCGAGATCTCCTAGGCTCACAAATTAGAGCTTCAATTTAATCloning the fragment of HXT7p-araB-PGKt1
Pgk6 downstream-SCATGTCGACAGCAATTTAACTGTGATAAACTACCGCloning the fragment of HXT7p-araB-PGKt1
Hxt7 upstreamCATCCTAGGCTCACAAATTAGAGCTTCAATTTAATCloning the fragment of HXT7p-araD-PGKt1
Pgk6 downstreamCATCCTAGGAGCAATTTAACTGTGATAAACTACCGCloning the fragment of HXT7p-araD-PGKt1
HXT7p-FCCCAAGCTTCTCACAAATTAGAGCTTCAATTCloning HXT7p
HXT7p-RACGCGTCGACATTGGATCTAGATGCATTCGCGCloning HXT7p
TEF1 W upCCCAAGCTTCACAATGCATACTTTGTACGTTCloning TEF1p
TEF1 W downGCGCGTCGACTTGTAATTAAAACTTAGATTAGCloning TEF1p
AraA W upACGCGTCGACATGTTATCTGTTCCTGATTATGCloning araA
AraA W down-HisTACGAGTCTTTAGTGGTGGTGGTGGTGGTGTTTTAAAAATGCTTTTGTCACloning araA
AraA-FCAAGCAGGTGGTGGTCATCATACFor quantitative real-time PCR of araA
AraA-RTACCAACCATTGTAGCGTAATCTTCCFor quantitative real-time PCR of araA
AraB-1FATGCAGCATTCGCACCTTTGFor quantitative real-time PCR of araB
AraB-1RCCTTCACCTGCTGTGGACATFor quantitative real-time PCR of araB
AraD-1FCCAGCTGCAGATGCATTAACTFor quantitative real-time PCR of araD
AraD-1RACAGCCTTAGCTGGTGTTGGFor quantitative real-time PCR of araD
Gal2 upGCTCTAGAATGGCAGTTGAGGAGAACAATATGCCloning GAL2
Gal2 downACGCGTCGACTTATTCTAGCATGGCCTTGTACCloning GAL2
pG418-Apa I upAGTGGGCCCTAGGTCTAGAGATCTGTTTAGCCloning KanMX4
pG418-Nde I downGGAATTCCATATGATTAAGGGTTCTCGAGAGCTCGCloning KanMX4