Table 2: NRAMP1 and VDR polymorphism sites and sequence variants.

NameNucleotide and amino acid changePrimers, 5′ to 3′Polymorphic siteGenopytesFragment (bp)

NRAMP1- 
3′UTR
Deletion of TGTG in the 3′UTR (55 nt 3′ to the last codon in exon 15) GCATCTCCCCAATTCATGGTTGTGdel/del240
AACTGTCCCACTCTATCCTGTGGA TGTGGATGTG+/del240, 211, 33
(240 or 242 bp)FokITGTG+/+211, 33
VDR-FokIA T/C transition
polymorphism in exon 2
AGCTGGCCCTGGCACTGACTCTGCTCTC/C-FF267
ATGGAAACACCTTGCTTCTTCTCCCTCCAGGGA TGGAGGT/C-Ff267, 197, 70
(267 bp) FokIT/T-ff197, 70
VDR-TaqIA single base change CAGAGCATGGACAGGGAGCT/T-TT455
C to T in codon 352 at the 3′ end of theAGGAGAGGCAGCGGTACTGACAGGAG CTCTT/C-Tt455, 290, 165
VDR gene(455 bp)TaqIC/C-tt290, 165

Note: Underlined letters denote different restriction sites in which bold letters represent polymorphism sites. Genotypes of both genes were defined as follows. For the NRAMP1 gene, individuals were scored as 3′UTR-TGTG+/+ wild homozygote, 3′UTR-TGTGdel/del mutant homozygote, and 3′UTRTGTG+/del heterozygote, respectively.
+= presence of TGTG; del = absence of these four bases.
For the VDR gene, individuals were scored as FokI-FF, TaqI-TT wild homozygotes, FokI-ff, TaqI-tt mutant homozygotes, FokI-Ff, and TaqI-Tt heterozygotes, respectively.