Table 3: The primers and product size for PCR-SSP genotyping of HLA-DRB1 and HLA-DQB1.

Primer sequence (5′ to 3′)Size of PCR products (bp)
ForRev

DRB1 allele
 01TTGTGGCAGCTTAAGTTTGAATCTGCACTGTGAAGCTCTCAC255
 03TACTTCCATAACCAGGAGGAGATGCAGTAGTTGTCCACCCG151
 04GTTTCTTGGAGCAGGTTAAACA′CTGCACTGTGAAGCTCTCAC260
 07CCTGTGGCAGGGTAAGTATACCCGTAGTTGTGTCTGCACAC232
 08AGTACTCTACGGGTGAGTGTT′CTGCAGTAGGTGTCCACCAG214
 09GTTTCTTGAAGCAGGATAAGTTTCCCGTAGTTGTGTCTGCACAC236
 10CGGTTGCTGGAAAGACGCCCTGCACTGTGAAGCTCTCAC204
 11GTTTCTTGGAGTACTCTACGTCCTGGCTGTTCCAGTACTCCT176
 12AGTACTCTACGGGTGAGTGTTCACTGTGAAGCTCTCCACAG248
 13ACTTCCATAACCAGGAGGAGACCCGCTCGTCTTCCAGGAT130
 14GTTTCTTGGAGTACTCTACGTCTCTGCAATAGGTGTCCACCT224
 15TCCTGTGGCAGCCTAAGAGCCGCGCCTGCTCCAGGAT197
 16TCCTGTGGCAGCCTAAGAGAGGTGTCCACCGCGGCG223
DQB1 allele
 0201GTGCGTCTTGTGAGCAGAAGGCAAGGTCGTGCGGAGCT 205
 0301/4GACGGAGCGCGTGCGTTAAGTACTCGGCGTCAGGCG 122
 0302/3GACGGAGCGCGTGCGTCT′AGTACTCGGCGTCAGGCG122
 0303GACGGAGCGCGTGCGTCTCTGTTCCAGTACTCGGCGT′129
 0304GACGGAGCGCGTGCGTTACTGTTCCAGTACTCGGCGG 129
 0401CACCAACGGGACCGAGCTGGTAGTTGTGTCTGCATACG200
 0402CACCAACGGGACCGAGCGGGTAGTTGTGTCTGCATACG 200
 0501CGGAGCGCGTGCGGGGCTGTTCCAGTACTCGGCAA128
 0502TGCGGGGTGTGACCAGACTGTTCCAGTACTCGGCGCT 117
 0503TGCGGGGTGTGACCAGACGCGGCGTCACCGCCCGA 87
 0504GTGCGGGGTCTGACCAGATTGTTCCAGTACTCGGCGCT 118
 0601GCCATGTGCTACTTCACCAATCACCGTGTCCAACTCCGCT 198
 0602CGTGCGTCTTGTGACCAGATGCTGTTCCAGTACTCGGCAT121
 0603/8GGAGCGAGTGCGTCTTGTAGCTGTTCCAGTACTCGGCAT127
 0604CGTGTACCAGTTTAAGGGCAGCAGGATCCCGCGGTACC 254

Note: For: former; Rev: reverse.