Table 1: Primers of genes used in quantitative real-time PCR.

PrimersForward 5′–3′Reverse 3′–5′

opnGTGCCATACCAGTTAAACAGCTTACTTGGAAGGGTCTGTG
runx2GAGATCATCGCCGACCACTACCTCTCCGAGGGCTACC
Collagen 1AGGGCCAAGACGAAGACA TCAGATCACGTCATCGCACA ACA
sp7CACAGCTCTTCTGACTGTCTGCTGGTGAAATGCCTGCATGGAT
vegfGCCTTGGTGCTCTACCTCCACGATTCTGCCCTCCTCCTTCTGG
ramp2CTGCTGGGCGCTGTCCTGAATTCTGACCCTGGTGTGCCTGTG
gapdhATGGGGAAGGTGAAGGTCTAAAAGCAGCCCTGGTGACC