Table 1: Primer sequence used to detect HPV-16, 31, 33, and 58 genotypes.

HPV genotype (LCR)Sequence primerAmplicon size (base pairs)

HPV-16F: 5′-TTCTGCAGACCTAGATCAGTTTC-3′ 
F: 5′-GTGCATAACTGTGGTAACTTTCTGG-3′
1057 bp
HPV-31F: 5′-TTAGATCAGTTTCCACTGGGTCG-3′ 
F: 5′-TTAGTTCATGCAATTTCCGAGGTC-3′
1152 bp
HPV-33F: 5′-TACCTCCAAAGGAAAAGGAAGACCC-3′ 
F: 5′-TTGGCACAAATCATGCAATGTTCG-3′
1184 bp
HPV-585′ CATGTTCTATGTCCTTGTCAG 3′ 
5′ TGA CCC AAA ACG GTT AGT CC 3′
1000 bp