Table 2: Details of specific primers used in Real-Time PCR experiments.

GenePrimer sequenceGenBank, accession numberAmplicon length, bpTemperature, °CEfficiency, %

CD39 F: CACAGCATAGTAGATTGACATNM_0017761036099.80.998
R: ATACGCAGACAGAAGGAA

CD73 F: TAAGCACACTGTCTCATTNM_002526116601010.999
R: CTGTATGGTCAAGTCAAC

YWHAZ F: ATGCAACCAACACATCCTATCNM_0011357021786095.30.997
R: GCATTATTAGCGTGCTGTCTT

TOP2b F: AACTGGATGATGCTAATGATGCTNM_0010681376098.40.998
R: TGGAAAAACTCCGTATCTGTCTC

SRP14 F: CAGATGGCTTATTCAAACCTCCTNM_0031341816099.90.998
R: ATGCCCTTTACTGTGCTGCT

CD39: ectonucleoside triphosphate diphosphohydrolase; CD73: ecto-5′-nucleotidase; YWHAZ: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein z polypeptide; TOP2b: topoisomerase II Beta; SRP14: signal recognition particle 14 kDa.