Table 1: The primers were used for the qRT-PCR.

GeneGB.accessionPrimer sequence

GAPDHFGTTGTCTCCTGCGACTTCA
RTGGTCCAGGGTTTCTTACTC
ActinFGAGATTACTGCTCTGGCTCCTA
RGGACTCATCGTACTCCTGCTTG
Bub1NM_001005856.1 FATGAAGCCACAACGTACCCA
RTCCTGCCGTCTACTCCTCTTG
Cdkn2b NM_007670.4FTTTGGGTGGGTGCAGTCAG
RTTCCTTGTCGAGCTGGAGGT
Chek1NM_007691.5FTGGATGCGGACAAATCTTACC
RACCAAACCTTCTGGCTGCTC
Gadd45a NM_007836.1FCTCATCCGTGCGTTCTGCT
RTCCATTGTGATGAATGTGGGTT
Cdk4 NM_009870.3FCAGTCTACATACGCAACACCCG
RCAAAGATTTTCCCCAACTGGTC
Cxcr4NM_009911.3FGCTGAAAAGGCAGTCTATGTGG
RACAGGCTATCGGGGTAAAGG
LhcgrNM_013582.2FACGCTGACCTACCCTAGCCA
RCCCAGCCACTGAGTTCATTCT
Ly6a NM_010738.2FCAATTCTTCCTGGAGCCCTCT
RCATGAGCAGCAATCCACAACA
Smad2NM_010754.5FCACCTTCATCACGCCTTGG
RTGGGCATCTGCTTTCTTTGA
Nr5a2NM_030676.3FTCAGTTCGATCAGCGGGAGT
RTTCACCTGCTCTTGGACACCT
Akr1c18NM_134066.2FCAAGTCCATCGGGGTGTCTAA
RGCAGCTTGCTCTGGTTGAGAT
Cyp4f15NM_134127.1FATGACCCCTTCCGCTTTGA
RCGCCACCTTCATCTCGTTC