- About this Journal
- Abstracting and Indexing
- Aims and Scope
- Annual Issues
- Article Processing Charges
- Articles in Press
- Author Guidelines
- Bibliographic Information
- Citations to this Journal
- Contact Information
- Editorial Board
- Editorial Workflow
- Free eTOC Alerts
- Publication Ethics
- Reviewers Acknowledgment
- Submit a Manuscript
- Subscription Information
- Table of Contents
BioMed Research International
Volume 2013 (2013), Article ID 720285, 6 pages
http://dx.doi.org/10.1155/2013/720285
Construction, Expression, and Characterization of Thymosin Alpha 1 Tandem Repeats in Escherichia coli
State Key Laboratory of Cancer Biology, Department of Biopharmaceutics, School of Pharmacy, Fourth Military Medical University, Xi'an 710032, China
Received 11 June 2012; Revised 26 November 2012; Accepted 26 November 2012
Academic Editor: Fabio Ferreira Perazzo
Copyright © 2013 Xiao-Chang Xue et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Thymosin alpha 1 (Tα1), which is composed of 28 amino acids, has been commercialized worldwide for its immune-modulatory and antitumor effects. Tα1 can stimulate T cell proliferation and differentiation from bone marrow stem cells, augment cell-mediated immune responses, and regulate homeostasis of immune system. In this study, we developed a novel strategy to produce Tα1 concatemer (Tα1) in Escherichia coli and compared its activity with chemically synthesized Tα1. Results showed that Tα1 can more effectively stimulate T cell proliferation and significantly upregulate IL-2 receptor expression. We concluded that the expression system for Tα1 concatemer was constructed successfully, which could serve as an efficient tool for the production of large quantities of the active protein.
1. Introduction
The tandem repeats of proteins and peptides are studied widely and formidable progress has been made in this field. It was reported that tandem amino acid repeats have many functions of stabilizing proteins [1], maintaining conformation [2], elevating activity, and increasing half-life of proteins in blood or tissues. Frasch and colleagues suggested that tandem repeats present in Trypanosoma cruzi transsialidase stabilized the catalytic activity. In addition, repeats present on T. cruzi shed proteins increased trans-sialidase half-life in blood from 7 to almost 35 h [3]. Some proteins that contain tandemly repeated sequences play important roles in cell membrane skeleton system [4, 5].
Thymosin alpha1 (Tα1) is a heat-stable, acidic polypeptide composed of 28 amino acid residues blocked at the N-terminus by an acetyl group [6, 7]. It is an immune modifier that has been shown to trigger lymphocytes maturation, augment T cell function, induce T-cell differentiation, and promote reconstitution of immune defects. All these findings showed that Tα1 could be a useful restorative therapeutic agent in the treatment of immunodeficiency diseases and immunosuppressed conditions [8–10].
In this study, Tα1 which was composed of three repeated copies of Tα1 was fuse-expressed with thioredoxin (trx) in E. coli TOP10 strain and purified by heat treatment and Q-Sepharose Fast Flow ion-exchange chromatography. Then, Tα1 was released by treatment with 0.5 M Cyanogen bromide (CNBr) and purified by SP-Sepharose Fast Flow chromatography. In our strategy, trx acts as a chaperon to help Tα1 folding and CNBr treatment removed any exogenous amino acid (such as Met at the N-terminus for translation start) from Tα1 molecule. So we can get the “natural” Tα1. Finally, the biological activity of Tα1 on T lymphocyte proliferation and IL-2R expression was assessed.
2. Materials and Methods
2.1. Materials
Restriction enzymes, Taq DNA polymerase, and T4 DNA ligase were purchased from TaKaRa. Expression vector pThioHisA and E. coli strain TOP10 (F-mcrAΔ(mrr-hsd RMS-mcrBC) φ80 lacZΔM15 ΔlacX74 recA1 araΔ139Δ(ara-leu)7697 galU galK rpsL (Strr)endA1 nupG) were from Invitrogen. DNA fragments were synthesized in BIOASIA. Synthetic Tα1 (ZADAXIN) was from Sciclone Pharmaceuticals, USA. The anti-Tα1 antibody (ab55635) was purchased from Abcam and FITC-anti-IL-2Rβ (18344D 554452) was from BD Pharmingen.
2.2. Tα1 Gene Amplification
Tα1 gene was cloned by gene synthesis and PCR (Figure 1). The forward primer (with an introduced EcoR I site) was p1: 5′-GGAATTCATGTCTGATGCAGCCGTGGAC ACCAGCAGCG-3′ and the reverse primer (with an introduced Pst I site) was p2: 5′-GCACTGCAGTCAGTTCTGGGCCTCCTCCACCACCT-3′. The template for PCR was annealing products of 4 synthesized fragments listed in Table 1. PCR product was cloned into pGEM-3Zf plasmid to obtain vector pGEM-Tα1 for identification.
2.3. Construction of Expression Vector pThioHisA-Tα1
The vector pGEM-Tα1 was digested with EcoR I and Pst I and cloned into expression vector pThioHisA digested with the same enzymes. The candidate plasmid pThioHisA-Tα1 was then confirmed by restriction enzymes digestion and DNA sequencing.
2.4. Expression of the Fusion Protein
The plasmid pThioHisA-Tα1 was transformed into E. coli TOP10 strain. A single colony was inoculated into 10 mL Luria-Bertani (LB) medium supplemented with ampicillin (100 μg/mL) and grown at 200 rpm and 37°C overnight. Then it was inoculated into 300 mL fresh LB medium in a 500 mL shake flask and cultured until the OD600 reached 0.5. Trx-Tα1 expression was induced by 1 mM IPTG (final concentration) for 4 h. Large scale fed-batch culture was performed in a 5-L fermentor as previously described [11].
2.5. Purification of Tα1
Cell pellet was suspended in 20 mM Tris/HCl buffer (pH 8.0) in proportion of 200 g/L and disrupted by sonication. Then, the lysate was incubated at 80°C for 10 min (shaken once every 2-3 min) and cooled quickly. Samples were centrifuged at 12 000 g for 20 min and the supernatant was loaded onto a Q-Sepharose Fast Flow chromatography column and eluted with linear NaCl gradient. The purified Trx-Tα1 was then cleaved by CNBr (0.5 M) in 70% formic acid for 24 h. The cleavage reaction was stopped by addition of ten times amount of H2O [12] and Tα1 was purified by SP-Sepharose Fast Flow chromatography. Purified Tα1 was dialyzed against PBS for later use.
2.6. Western-Blot Analysis
Proteins were transferred to nitrocellulose membranes (0.22 μm, Invitrogen) after SDS-PAGE using a Bio-Rad Semi-Dry electrophoretic cell. Western blot analyses were carried out using a Tα1 specific antibody and followed by a phosphatase-conjugated goat anti-mouse IgG (Boster, China). Western Blue Stabilized Substrate (Promega) for alkaline phosphatase was used for visualization.
2.7. Biological Activity Assay
The proliferation response of splenocytes was determined by MTT assay. Spleens from C57BL6 mice were dispersed through nylon mesh to generate a single-cell suspension. Then lymphocytes were separated by EZ-Sep 1× Lymphocyte Separation Medium (DKW33-R0100, Dakewe Biotech Company, China) and suspended at 4 × 106/mL in RPMI 1640 media. For proliferation assay, cells were seeded in 96-well plates (4 × 105/well) and cultured in the presence of 2.5 μg/mL concanavalin A (ConA) at 37°C in 5% CO2 in humid air. Six h later, 90 μL of Tα1 diluted with RPMI 1640 media was added to all but the control wells. The synthetic Tα1 and media were used as positive and negative controls. After 66 h incubation, 20 μL of MTT (0.5 mg/mL) solution was added and the plates were centrifuged (2000 rpm, 25°C, 10 min) 4 h later. Supernatants were discarded, and 100 μL of DMSO was added. After incubated at room temperature for 10 min, the solubilized reduced MTT was measured at 570 nm using a Bio-Rad plate reader and the optical densities were used for calculate growth rate with the formula
To evaluate the effect of Tα1 on the expression level of IL-2R on T lymphocytes, cells were isolated as before and cultured in the presence of ConA and Tα1. The synthetic Tα1 and a recombinant Tα1 monomer prepared in our lab were used as positive controls. Cells were collected and stained 48 h later according to standard protocol. In brief, 5 × 105 cells were washed with PBS and stainedin “FACS buffer” (PBS with 0.1% sodium azide, 2% FBS, and 1 μM EDTA) with FITC-anti-mIL-2Rβ for 10 min at room temperature. After washing, cells were fixed for 30 minutes on ice with 4% paraformaldehyde and analyzed on a FACSCalibur flow cytometer (BD Biosciences).
3. Results and Discussion
3.1. Tα1 Gene Cloning
Although synthetic Tα1 has been successfully applied in clinical trials for immunodeficiency diseases therapy, the high costs is still a hard nut to crack. Fortunately, molecular biology techniques allowed us to produce recombinant Tα1 in E. coli. Considering that Tα1 is too small to be directly expressed in E. coli, it was usually assembled as concatemers. But some exogenous amino acid residues such as His6 tag or methionine (Met) introduced by the initiation codon AUG usually affects the effect of concatemers [13].
In order to produce the real “natural” concatemers of Tα1, we put forward a new strategy as showed in Figure 1. By this strategy, we obtained a series of Tα1 concatemers in which Tα1 that was assembled by three repeated copies of Tα1 gene owned highest proportion. After cloning into pGEM-3Zf vector, the gene was proven by enzyme digestion and DNA sequencing. The sequence of Tα1 gene was consistent with our design as follows: 5′-atgagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaactga-3′.
3.2. Expression of Recombinant Fusion Protein
Both SDS-PAGE (Figure 2(a)) and Western blot (Figure 2(f)) analyses of the induced supernatant from pThioHisA-Tα1/TOP10 showed that a new 31 kDa protein which can be specifically recognized by Tα1 antibody was produced. It suggested that trx-Tα1 was successfully expressed. Trx was used as a chaperon to guarantee the correct folding of Tα1 and trx-Tα1 was expressed as a soluble fusion protein.
3.3. Purification of Tα1
Both trx and Tα1 are heat-stable proteins, so trx-Tα1 was easily purified by one-step Q-Sepharose Fast Flow chromatography after the lysate of recombinant bacterial cells was heated at 80°C for 10 min (Figures 2(b) and 2(d)). Then, the purified trx-Tα1 was cleaved by CNBr, and Tα1 was purified by SP-Sepharose Fast Flow chromatography (Figures 2(c) and 2(e)). 2L-Tricine-SDS-PAGE [14] and HPLC analyses were used to identify the purity of Tα1. CNBr treatment was utilized here to remove the redundant Met from the N-terminus of Tα1 to obtain the real “natural” molecule.
3.4. Biological Activity of Tα1
We expected that the tandem repeats could obtain stronger activity through elongating the half-life of Tα1 and simulating polymerization of monomer molecules and thereafter triggering the polymerization and activation of receptors which was usually used by molecules to gain function.
To examine the effect of Tα1 on stimulating the proliferation of splenic lymphocytes, we compared the proliferation ratio of mice lymphocytes treated with synthetic Tα1 ZADAXIN and Tα1. MTT assay results showed that 40 μg/mL synthetic Tα1 could induce significant proliferation of lymphocytes compared to the control (), whereas 5 μg/mL Tα1 could induce significant proliferation (). Furthermore, the effect of 10 μg/mL Tα1 was stronger than that of 40 μg/mL synthetic Tα1 (Figure 3).
In addition, the upregulation of IL-2R on lymphocytes by ZADAXIN purified recombinant Tα1 monomer and Tα1 was compared. Results showed that when costimulated with ConA, IL-2R expression level on T cell was upregulated by all these three molecules and Tα1 obtained strongest effect (Figure 4).
4. Conclusions
Trx-Tα1 was expressed in E. coli as a soluble form and the real “natural” Tα1 was conveniently purified by heat treatment and ion-exchange chromatography. As expected, the bioactivity of Tα1 was stronger than that of synthetic Tα1. Lower dose (5 μg/mL) of Tα1 apparently stimulated the proliferation of T lymphocytes compared with that of ZADAXIN (40 μg/mL). In addition, Tα1 significantly upregulated IL-2R on T cell, which is very important for T cell activation and proliferation in vivo. The detailed mechanism for stronger effect of Tα1 and the pharmacokinetics of different tandem repeats are still under investigation.
Acknowledgment
This project was supported by the Natural Science Fund of China (Project no. 31000406).
References
- R. I. MacDonald and E. V. Pozharski, “Free energies of urea and of thermal unfolding show that two tandem repeats of spectrin are thermodynamically more stable than a single repeat,” Biochemistry, vol. 40, no. 13, pp. 3974–3984, 2001. View at Publisher · View at Google Scholar · View at Scopus
- J. Varea, J. L. Saiz, C. López-Zumel et al., “Do sequence repeats play an equivalent role in the choline-binding module of pneumococcal LytA amidase?” Journal of Biological Chemistry, vol. 275, no. 35, pp. 26842–26855, 2000. View at Publisher · View at Google Scholar · View at Scopus
- C. A. Buscaglia, J. Alfonso, O. Campetella, and A. C. C. Frasch, “Tandem amino acid repeats from Trypanosoma cruzi shed antigens increase the half-life of proteins in blood,” Blood, vol. 93, no. 6, pp. 2025–2032, 1999. View at Scopus
- A. Schneider, A. Hemphill, T. Wyler, and T. Seebeck, “Large microtubule-associated protein of T. brucei has tandemly repeated, near-identical sequences,” Science, vol. 241, no. 4864, pp. 459–462, 1988. View at Scopus
- P. C. Cotrim, G. Paranhos-Baccala, M. R. Santos et al., “Organization and expression of the gene encoding an immunodominant repetitive antigen associated to the cytoskeleton of Trypanosoma cruzi,” Molecular and Biochemical Parasitology, vol. 71, no. 1, pp. 89–98, 1995. View at Publisher · View at Google Scholar · View at Scopus
- A. L. Goldstein, T. L. Low, M. McAdoo et al., “Thymosin alpha 1: isolation and sequence analysis of an immunologically active thymic polypeptide,” Proceedings of the National Academy of Sciences of the United States of America, vol. 74, pp. 725–729, 1977. View at Publisher · View at Google Scholar
- T. L. K. Low and A. L. Goldstein, “The chemistry and biology of thymosin. II. Amino acid sequence analysis of thymosin α1 and polypeptide β1,” Journal of Biological Chemistry, vol. 254, no. 3, pp. 987–995, 1979. View at Scopus
- F. Salvati, G. Rasi, L. Portalone, A. Antilli, and E. Garaci, “Combined treatment with thymosin-alpha1 and low-dose interferon-alpha after ifosfamide in non-small cell lung cancer: a phase-II controlled trial,” Anticancer Research, vol. 16, no. 2, pp. 1001–1004, 1996. View at Scopus
- S. Moscarella, G. Buzzelli, R. G. Romanelli et al., “Interferon and thymosin combination therapy in naive patients with chronic hepatitis C: preliminary results,” Liver, vol. 18, no. 5, pp. 366–369, 1998. View at Scopus
- F. Pica, M. Fraschetti, C. Matteucci, C. Tuthill, and G. Rasi, “High doses of thymosin alpha 1 enhance the anti-tumor efficacy of combination chemo-immunotherapy for murine B16 melanoma,” Anticancer Research, vol. 18, no. 5, pp. 3571–3578, 1998. View at Scopus
- X. Xue, Z. Wang, Z. Yan, J. Shi, W. Han, and Y. Zhang, “Production and purification of recombinant human BLyS mutant from inclusion bodies,” Protein Expression and Purification, vol. 42, no. 1, pp. 194–199, 2005. View at Publisher · View at Google Scholar · View at Scopus
- J. Kim, J. M. Park, and B. J. Lee, “HIGH-level expression and efficient purification of the antimicrobial peptide gaegurin 4 in E. coli,” Protein and Peptide Letters, vol. 4, no. 6, pp. 391–396, 1997. View at Scopus
- Y. Chen, L. Zhao, G. Shen et al., “Expression and analysis of thymosin α1 concatemer in Escherichia coli,” Biotechnology and Applied Biochemistry, vol. 49, no. 1, pp. 51–56, 2008. View at Publisher · View at Google Scholar · View at Scopus
- J. H. Shi, Y. T. Zhao, J. L. Wang, W. Han, Z. Yan, and Y. Q. Zhang, “Analysis of low molecular peptides by sodium dodecyl sulfate-polyacrylamide gel electrophoresis,” Journal of the Fourth Military Medical University, vol. 21, no. 6, pp. 761–763, 2000.