Table 1: Hyper-PCR primers.

PathogenPrimerBase sequence (5′-3′)PolarityReference

RSV-ARSA-FTGC AAG CAG AAA TGG AAC AAG T+ [14]
 106 bpRSA-RAAT AAT GAT GCT TTT GGG TTG TTC A

RSV-BRSB-FGATGGCTCTTAGCAAAGTCAAGTTAA+ [15]
 104 bpRSB-RTGTCAATATTATCTCCTGTACTACGTTGAA

Parainfluenza 1PIS1+CCGGTAATTTCTCATACCTATG+ [16]
 317 bpPIS1−CCTTGGAGCGGAGTTGTTAAG

Parainfluenza 3Para3.1CTCGAGGTTGTCAGGATATAG+ [16]
 189 bpPara3.2CTTTGGGAGTTGAACACAGTT

RhinovirusSRHI-1-NIIDCGGGTAGCTTCCACCACCAGCCCTT+ [16]
 549 bpSRHI-2GGGACCAACTACTTTGGGTGTCCGTGT

EnterovirusentR1ATTGTCACCATAAGCAGCCA+ [17]
 172 bpentE2CCTCCGGCCCCTGAATG

H1N1 2009swH1-F2TCATGCGAACAATTCAACA+Present study
 127 bpswH1-R2TGGGGCTACCCCTCTTAGTTTG