Table 1: Sequences for qPCR primers.

Gene nameGene IDForward primerReverse primer

18S ribosomal RNA18S rRNACCCGAAGCGTTTACTTTGAACCCTCTTAATCATGGCCTCA
Dopamine transporter (DAT)Slc6a3GCCCATTTATGCGACCTACAGATGGTCTTTCTCAGGTGTGATG
Tyrosine hydroxylaseTHTGTGTCCGAGAGCTTCAATGGCTGGATACGAGAGGCATAGTTC
Glial fibrillary acidic proteinGfapCAACCTCCAGATCCGAGAAAGCTCCTGCTTCGACTCCTTA
Nuclear orphan receptor (Nurr1)Nr4a2CGATCAGGACCTGCTTTTTGCTGGGTTGGACCTGTATGCT
Vesicular monoamine transporter 2 (Vmat2)Slc18a2AGACCATGTGTTCCCGAAAGCACATAGCCACCTTCCCATT
Glutamic acid decarboxylase 65 (GAD65)Gad2TTGCGAGTTCTGGAAGACAAAGATGACCATGCGGAAGAAG
Vesicular glutamate transporter 2 (VGlut2)Slc17a6GATATTGCCCCGAGATATGCCCATTCTTCACGGGACTTGT