Table 1: Oligonucleotides and siRNAs used in this work for RT-PCR and interference of Gln6Pi in E. histolytica, respectively.

Target genePrimer nameSequence (5′ to 3′)

gln6Pi Gln6PiEh-FATGTCATCCACAAACGAAAATATTC
gnl6Pi Gln6PiEh-RCAATAGACATGGATTTATCATATC
EhARF EhARF-FGTAGGACTTGATGCTGCC
EhARF EhARF-RTCACCATTAGTTGCAC
gln6Pi-mRNA siRNA 154-Gln6PiGGACAUGCAGUAUUAGGAUTT
gln6Pi-mRNA Si 229-Gln6PiGCUGGAGAAGUUUCAUUUATT
siRNA-A:sc37007

Controls for constitutive expression (ARF primers) and specificity of interference (siRNA-A) are also shown.