Table 1: Primers.

Strain and a name of the primer5′-3′ nucleotide sequence of the primerReference and a reaction where a primer was used

10Dp66E, 16S27F AGAGTTTGATCCTGGCTCAGPCR
1Dp66E-1, 2Dp86E
16S378F
GGGGAATTTTCCGCAATGGG[23], PCR
1Dp66E-1, 2Dp86E, 10Dp66E
23S30R
CTTCGCCTCTGTGTGCCTAGGT[24], PCR
1Dp66E-1, 2Dp86E
16S534F
GCCCACAGCTCAACTGTGGThis work, PCR
1Dp66E-1, 2Dp86E
23S1665R
CGCTCTAACCACCTGAGCThis work, PCR
2Dp86E
CYA781 Rfil
GACTACTGGGGTATCTAATCCCATTThis work, sequencing
1Dp66E-1
CYA781Rnonfil
GACTACAGGGGTATCTAATCCCTTTThis work, sequencing
2Dp86E
FIL6F
CATGTCGCGAATCTTTCAGThis work, sequencing
2Dp86E
FIL7F
CGTCCTACAATGCTACAGACThis work, sequencing
2Dp86E
FIL8F
CGAGTGGTCACTCTAGGThis work, sequencing
2Dp86E
FIL9F5
CGACTGACTGGACTAATGGThis work, sequencing
2Dp86E
FIL10R
AACCGCTGACATCCTGCTThis work, sequencing
2Dp86E
FIL11R
GTGAGCCCGTTGTAGCTTThis work, sequencing
1Dp66E-1
UNI 3F
ATGGACGAAAGCCAGGGGAGCThis work, sequencing
1Dp66E-1
UNI 4R
GACCTGCGATTACTAGCGATGThis work, sequencing
1Dp66E-1
UNI 5F
GGCGTTCAACGTGTCCGATCCThis work, sequencing
1Dp66E-1
UNI 6R
GAGTCCTCAGCTGAACATGTCCThis work, sequencing
1Dp66E-1
UNI 7F
GTGAGCCCGTTGTAGCTTThis work, sequencing
1Dp66E-1
UNI 1F
CTCGGTGTCGTAGCTAACGCThis work, sequencing
1Dp66E-1
UNI 1R
CATCCTGCTTGCAAAGCAGThis work, sequencing
1Dp66E-1
UNI 8R
GAGGTTTACAGCCCAGAGThis work, sequencing
1Dp66E-1
UNI 9R
GCATCGAATTAAACCACThis work, sequencing
1Dp66E-1
UNI 10F
GACAGGTGGTGCATGGCThis work, sequencing
10Dp66E
10Dp F
GCTGACCTGCAATTACTAGCThis work, sequencing
10Dp66E
10Dp R
GCGCTTTCGCCACCGGTGTTCThis work, sequencing
1Dp66E-1, 2Dp86E
16S15-12-08F
GCCCACAGCTCAACTGTGGThis work, sequencing
1Dp66E-1, 2Dp86E
23S15-1208R
GGCCATCCTGGACTCGAACThis work, sequencing
1Dp66E-1, 2Dp86E
23S16-1208R
CGCTCTAACCACCTGAGCThis work, sequencing
1Dp66E-1, 2Dp86E
23S31R
CTCAACCATAGTCTAGAAACThis work, sequencing
1Dp66E-1, 2Dp86E
23S32R
GTCCTGAACGACCTAGAGThis work, sequencing